Atormac
Neurology India
Open access journal indexed with Index Medicus
  Users online: 2377  
 Home | Login 
About Current Issue Archive Ahead of print Search Instructions Online Submission Subscribe Videos Etcetera Contact
  Navigate Here 
 Search
 
  
 Resource Links
  »  Similar in PUBMED
 »Related articles
  »  Article in PDF (1,662 KB)
  »  Citation Manager
  »  Access Statistics
  »  Reader Comments
  »  Email Alert *
  »  Add to My List *
* Registration required (free)  

 
  In this Article
 »  Abstract
 »  Materials and Me...
 » Results
 » Discussion
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed383    
    Printed14    
    Emailed0    
    PDF Downloaded29    
    Comments [Add]    

Recommend this journal

 


 
Table of Contents    
NI FEATURE: PATHOLOGICAL PANORAMA - ORIGINAL ARTICLE
Year : 2018  |  Volume : 66  |  Issue : 4  |  Page : 1106-1114

MGMT gene promoter methylation and its correlation with clinicopathological parameters in glioblastomas


1 Department of Pathology, Division of Molecular Pathology, Tata Memorial Centre, Mumbai, Maharashtra, India
2 Department of Radiation Oncology, Division of Surgical Oncology, Tata Memorial Centre, Homi Bhabha National Institute, Mumbai, Maharashtra, India
3 Department of Neurosurgical, Division of Surgical Oncology, Tata Memorial Centre, Homi Bhabha National Institute, Mumbai, Maharashtra, India

Date of Web Publication18-Jul-2018

Correspondence Address:
Dr. Sridhar Epari
Department of Pathology, ACTREC and Tata Memorial Hospital, Tata Memorial Centre, Mumbai, Maharashtra
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0028-3886.236974

Rights and Permissions

 » Abstract 


Background: MGMT (O6-methyl guanine DNA methyl transferase) promoter hypermethylation is a prognostic and predictive biomarker for glioblastomas (GBM).
Aims: To evaluate the frequency of MGMT methylation status in a single institute series of 134 GBMs and correlate it with clinical (age, sex, location, survival) and other molecular parameters [such as p53 expression, alpha thalassemia/mental retardation syndrome X-linked (ATRX) expression, isocitrate dehydrogenase (IDH) 1R132H mutation, and epidermal growth factor receptor (EGFR) gene amplification].
Results: One hundred and thirty-four GBMs were evaluated by methylation-specific polymerase chain reaction (MSP) for MGMT promoter methylation status. The results were correlated with the above mentioned clinicopathological parameters. MGMT gene promoter methylation was identified in 49.2% (66/134) GBMs, and was significantly associated with IDH1R132H mutation (14/66; 21%; P - value, 0.01) and ATRX loss (15/66; 23%; P - value, 0.01). Confluent necrosis was found to be significantly associated with MGMT unmethylation status (P - value: 0.002). Multivariable logistic regression analysis showed confluent necrosis as a single independent predictor (odds ratio [OR], 2.5; confidence interval [CI], 1.0–5.8; P - value, 0.04) of MGMT unmethylation status among all the parameters studied.
Conclusions: The frequency of MGMT promoter methylation in GBMs was 49.2%, which was significantly associated with IDHR132H mutation and ATRX loss. In addition, the presence of confluent necrosis was significantly associated with MGMT unmethylation and was found to be an independent predictor of the same.


Keywords: ATRX protein, EGFR gene amplification, glioblastoma, IDH1/2 mutation, MGMT promoter methylation, necrosis
Key Message: MGMT gene promoter methylation was identified in 49.2% of the glioblastomas assessed, and was significantly associated with IDH1R132H mutation and ATRX loss. Confluent necrosis emerged as the single independent predictor of MGMT unmethylation status.


How to cite this article:
Arora I, Gurav M, Rumde R, Dhanavade S, Kadam V, Kurani H, Shetty O, Goda JS, Shetty P, Moiyadi A, Gupta T, Jalali R, Epari S. MGMT gene promoter methylation and its correlation with clinicopathological parameters in glioblastomas. Neurol India 2018;66:1106-14

How to cite this URL:
Arora I, Gurav M, Rumde R, Dhanavade S, Kadam V, Kurani H, Shetty O, Goda JS, Shetty P, Moiyadi A, Gupta T, Jalali R, Epari S. MGMT gene promoter methylation and its correlation with clinicopathological parameters in glioblastomas. Neurol India [serial online] 2018 [cited 2018 Nov 18];66:1106-14. Available from: http://www.neurologyindia.com/text.asp?2018/66/4/1106/236974




Glioblastoma (GBM) is the most common, and unfortunately, the most aggressive primary malignant brain tumor. The median survival of GBM patients with treatment is 12–18 months.[1],[2] Traditionally, GBS are classified as primary (de novo), or secondary, arising from a low-grade glioma. Currently, the common molecular markers for adult diffuse gliomas in clinical practice are IDH1/2 mutations, 1p19q co-deletion, telomerase reverse transcriptase (TERT promoter mutations), MGMT methylation, ATRX expression, TP53 mutations, epidermal growth factor receptor (EGFR) amplification (including EGFRvIII mutant), and phosphatase and tensin homolog (PTEN) alterations.[3],[4],[5]

Evaluation for IDH mutations [initially by immunohistochemistry (IHC) evaluation for IDH1R132H, followed by sequencing for IDH1/2 mutations only in IHC negative cases], 1p19q co-deletion by fluorescent in-situ hybridization (FISH), TERT promoter mutations by sequencing, MGMT methylation by methylation-specific polymerase chain reaction [PCR] (MSP), quantitative MSP (qMSP) and pyrosequencing, ATRX expression and p53 over-expression by IHC and EGFR amplification by FISH, are the current preferred standard methods of detection in routine clinical practice. However, two large trials from European Organization for Research and Treatment of Cancer (EORTC) and National Cancer Institute of Canada (NCIC) groups demonstrated the prognostic and predictive role of MGMT promoter methylation by MSP methodology in high-grade glioma (HGG) patients for alkylating agent-based chemotherapy.[1]

In this study, we evaluated adult GBMs for MGMT methylation by MSP and correlated its presence with other molecular (IDH1R132H mutations, ATRX expression, p53 expression, EGFR amplification), histological, and clinical parameters.


 » Materials and Methods Top


Sample

One hundred and thirty-four cases of non-brainstem GBMs retrieved from adult (>18 years) patients and diagnosed at our centre from June 2014 to June 2015, which were evaluated for MGMT methylation as a part of the routine clinical management, formed the study sample. The relevant clinical data (age, sex, location of tumor) were retrieved from the hospital electronic medical records.

Histology

All cases were reviewed and re-confirmed based upon the 2007 4th World Health Organization (WHO) classification of tumors of the nervous system. These were subtyped into different established histomorphological patterns as follows:

  • Giant cell pattern (GBM-G): Predominant portion of the tumor composed of extremely large tumor cells
  • Small cell pattern (GBM-S): Monomorphic proliferation of small round cells with hyperchromatic nuclei, indistinct cytoplasm, and no significant nuclear anisokaryosis
  • Sarcomatous differentiation (gliosarcoma, GS): Any amount of heterogeneous sarcomatous/mesenchymal differentiation with unequivocal component of glial tumor. The sarcomatous component was established by the presence of reticulin rich fibres with immunonegativity for glial fibrillary acidic protein (GFAP) and S-100 protein
  • Oligodendroglial differentiation (GBM-O): Presence of at least one high power field of unequivocal area of oligodendroglial morphology with large confluent areas of necrosis
  • Ependymal differentiation (GBM-E): Presence of any histomorphologically component resembling perivascular ependymal rosette-like morphological area coupled with immunopositivity for epithelial membrane antigen (EMA) and large confluent areas of necrosis in an unequivocally infiltrating glial tumor
  • GBM-NOS: Rest of the cases with features of GBM were classified as GBM-NOS (not otherwise specified).


Immunohistochemistry (IHC)

IHC for p53 protein (Dako, D07, 1:50 dilution), ATRX (Sigma, polyclonal, 1:750 dilution), and IDH1R132H (Dianova H06; 1:100 dilution) were done for all cases on 4-μm formalin-fixed paraffin-embedded tissue (FFPE) sections using the Ventana automated stainer by the polymer detection kit.

  • p53 protein expression was graded as follows:[6]
  • Positive: >50% tumor cells showed staining with strong intensity
  • Focal positive: <10% of tumor cells with strong nuclear positivity, 10–50% tumor cells with strong intensity staining, and >50% cells with moderate intensity staining
  • Negative: Rest of the patterns – occasional cells (<10%) with weak or moderate intensity staining or no staining
  • For comparison with other molecular parameters, the p53 expression pattern was grouped into two broad categories of positive (or over-expression) and nonpositive (focal positive and negative were grouped as nonpositive).


  • IDH1R132H:


    • Positive: Tumor showing positivity diffusely
    • Negative: No tumor cells showing positivity
    • Noncontributory: Lack of uniform areas of positivity.


  • ATRX:


    • Retained: When any amount of tumor showed nuclear staining
    • Loss: No portion of the tumor showing nuclear positivity in the presence of positivity in the endothelial cells and/or caught up neurons
    • Equivocal: Mosaic patterns of positivity
    • Noncontributory: When no native normal tissue showed nuclear staining.


    DNA extraction

    Genomic DNA was isolated from five 10-μM paraffin sections using a genomic DNA extraction kit (QIAamp DNA Mini Kits, Qiagen.), quantified on Nanodrop Lite Spectrophotometer, and used for both Sanger sequencing and MS-PCR.

    MSP for MGMT gene promoter methylation

    Genomic DNA (500 ng) from each sample was modified by sodium bisulfite treatment (MethylEasy Xceed Rapid DNA modification kit, Human Genetics signature, Australia). The modified DNA was subjected to MSP using a two-step approach with HOTSTAR TAQ Mastermix (QIAGEN India Pvt. Ltd) and nested primers for methylated MGMT (Forward 5'-TTTGTGTTTTGATGTTTGTAGGTTTTTGT; reverse AACTCCACACTCTTCCAAAAACAAAACA) and unmethylated MGMT (Forward 5'-TTTC GACGTTCGTAGGTTTTCGC; Reverse 5'-GCACTCT TCCGAAAACGAAACG). MGMT methylation pattern was graded as:

    • Methylated (M): Presence of unequivocal band on methylated reaction either with complete absence or with a weak intensity band on unmethylated reaction
    • Low methylation or methylation of unknown significance (LM): When the band on methylation was weak with a band of same intensity or more in the unmethylated reaction. For statistical analysis, LM cases were included in the methylated group
    • Unmethylated (UM): No band on methylated reaction with the presence of band in the unmethylated PCR
    • Uninterpretable: When no band was detected on either methylated or unmethylated reaction.


    Fluorescence in-situ hybridization

    EGFR gene amplification was done using the dual color probe comprising locus-specific identifier probes for EGFR Spectrum Orange/CEP7 Spectrum Green Probe from Vysis (Abbott Laboratories, Downers Grove, IL, USA) on 3μ representative tumor fomalin fixed paraffin embedded (FFPE) section mounted on double poly-L lysine coated slides. Slides were evaluated using an Olympus BX53F upright fluorescence microscope equipped with appropriate excitation and emission filters for visualization of the orange and green signals, QIcam (Q34130) Olympus camera, and Qcapture pro 7.0 image analyser software.[6]

    For all cases, at least 100 non-overlapping intact tumor cell nuclei were evaluated, and the numbers of EGFR (red) and CEP7 (green) signals/nuclei were recorded. The mean signal number for the EGFR gene (red) and CEP7 (green) was calculated for each case followed by the calculation of EGFR gene/CEP7 ratio. The EGFR gene was quantified as:

    • Amplified: Mean tumor cell EGFR/CEP7 signal ratio >2 or when EGFR gene (red) signals were seen in large clusters
    • Non-amplified: Mean tumor cell EGFR/CEP7 signal ratio <2
    • Uninterpretable: No signals or interpretable signals seen in <40 interpretable cells.


    Statistical analysis

    Comparison of MGMT promoter methylation status with age, sex, location, p53 expression, ATRX expression, IDH1R132H mutation EGFR amplification, confluent necrosis, pseudo-palisading necrosis, and calcification was done by applying chi-square and Fisher's exact tests using IBM Statistical Package for the Social Sciences (SPSS) Software 22 version. Non-contributory/uninterpretable results were excluded from the analysis. A P - value of <0.05 was considered statistically significant.

    The association of MGMT methylation status as a dependent variable with other clinicopathological parameters was evaluated by logistic regression analysis. A univariable logistic regression analysis was performed followed by a multivariable regression analysis. Variables with a P value <0.20 on univariable model were selected for multivariable regression analysis. Odds ratio (OR) and 95% confidence intervals (CI) were also calculated for each parameter in the study.


     » Results Top


    One hundred and thirty-four cases of histologically diagnosed cases of GBM (molecularly unaided) with interpretable MGMT formed the study population.

    Clinical

    The predominant location was the cerebral hemisphere (n: 130; frontal: 50; occipital: 6; parietal: 22; temporal: 52); others included thalamus (n: 2), cerebellum (n: 1), and corpus callosum (n: 1). The male (M) to female (F) ratio was 3.3:1 (M: 103; F: 31). The median age was 51 years, ranging from 20–75 years (≤30 years: 15; 31–40 years: 24; 41–50 years: 22; 51–60 years: 41; >60 years: 32). The follow-up data was available in 93 patients with a median follow-up of 8 months (range, 0.10–148 months). Sixteen patients died of the disease, with a median overall survival of 8.6 months, ranging from 0.10 to 148 months.

    Histology

    The predominant histological type was GBM-NOS [Figure 1]a (n = 105; ≤30 years: 11; 31–40 years: 19; 41–50 years: 19; 51–60 years: 31; >60 years: 25). Others include GBM-O (n = 20; ≤30 years: 1; 31–40 years: 3; 41–50 years: 3; 51–60 years: 8; >60 years: 5), GBM-S (n = 1; >60 years), GBM-G (n = 3; ≤30 years: 2; 51–60 years: 1), GBM-E (n = 2; ≤30 years: 1; >60 years: 1), GS (n = 3; 31–40 years: 2; 51–60 years: 1) [Figure 1]b.
    Figure 1: Photomicrographs representative of glioblastoma-NOS (a: Hematoxylin and eosin [HE] x100), gliosarcoma (b: HE x100), immunohistochemistry positive for IDH1R132H mutation (c: IHCx100), immunohistochemistry positive for p53 protein (d: IHCx100), immunohistochemistry for ATRX protein (e: IHCx100 – retained protein, f: IHCx200 – loss of protein), EGFR FISH (g and h: FISH; g: amplified, h:non-amplified)

    Click here to view


    Calcification was seen in 15 cases (GBM-NOS: 12; GBM-O: 3). Confluent necrosis was seen in 92 (GBM-NOS: 69; GBM-G: 1; GBM-E: 1; GS: 3, GBM-O: 18), and pseudo-palisading necrosis in 22 cases (GBM-NOS: 13; GBM-G: 1; GBM-O: 7; GS: 1).

    MGMT promoter methylation [Figure 2]
    Figure 2: Electropherogram of methylation-specific PCR. The left half is of methylated PCR reaction and the right half of unmethylated PCR reaction of a few cases. (RC: Reagent control, PC METH: Positive control for methylated reaction, PC UNMETH: Positive control for unmethylated reaction, S No: Serial Number, M: Methylated, LM: Low methylated, UM: Unmethylated)

    Click here to view


    MGMT promoter was methylated in 66 cases [M: 52; LM: 14] (GBM-NOS: 48; GBM-S: 1; GBM-G: 2; GBM-E: 1; GS: 2, GBM-O: 12). The median ages for the MGMT methylated and the unmethylated cases were 51 years (range, 21–75 years; <=30 years: 8; 31–40 years: 11; 41–50 years: 11; 51–60 years: 19; >60 years: 17) and 51.5 years (range, 20–74; ≤30 years: 7; 31–40 years: 13; 41–50 years: 11; 51–60 years: 22; >60 years: 15), respectively. The male: female ratio of the MGMT methylated cases was 3.4:1 (51/15). Of the 16 patients who died of the disease, 10 had a methylated and 6 had an unmethylated GBM.

    EGFR amplification

    EGFR was interpretable in 119 cases; 27 were amplified [Figure 1]g (GBM-NOS: 19; GBM-O: 6, GBM-S: 1; GBM-E: 1), and 92 cases were non-amplified [Figure 1]h. The median age for EGFR amplified and non-amplified cases was 55 years (≤30 years: 1; 31–40 years: 4; 41–50 years: 3; 51–60 years: 10; >60 years: 9) and 51 years (≤30 years: 12; 31–40 years: 17; 41–50 years: 15; 51–60 years: 27; >60 years: 21), respectively. The male: female ratio of EGFR amplified cases was 1.8:1 (M: 18; F: 10).

    IDH1R132H mutation and ATRX expression

    All cases were evaluated for IDH1R132H mutation by IHC, of which 18 were positive (GBM-NOS: 17; GBM-O: 1) [Figure 1]c, and 116 (GBM-NOS: 88; GBM-O: 19; GBM-S: 1; GBM-E: 2; GBM-G: 3; GS: 3) were negative.

    ATRX expression was retained in 98/134 cases [Figure 1]e (GBM-NOS: 75; GBM-O: 16; GBM-S: 1; GBM-E: 2; GBM-G: 1; GS: 3), lost in 20 [Figure 1]f (GBM-NOS: 18; GBM-G: 2), equivocal in 5, and noncontributory in 11 cases. Three (of 98) ATRX retained cases, 13 (of 20) cases with ATRX loss, and one case each of ATRX equivocal (of 5) and non-contributory (of 11), respectively, were positive for IDH1R132H mutation on IHC.

    Of the 102 IHC IDH1R132H negative cases with interpretable ATRX results, 95 showed retained expression and 7 showed a loss for ATRX protein. Of the 16 IHC IDH1R132H positive cases, 3 showed retained expression and 13 showed loss of ATRX expression.

    Additional Sanger sequencing for IDH1/2 was done in 56/116 IHC IDH1R132H negative cases (of these 56 cases, the ATRX results were – loss: 6; retained: 42; equivocal: 4, non-contributory: 4). One of these 56 IDH1R132H IHC negative cases showed IDHR132S mutation (which showed ATRX loss and was EGFR non-amplified). However, 5 other ATRX loss cases did not show any IDH1/2 mutations.

    p53 protein expression

    On IHC, p53 was positive (over-expressed) in 55 cases [Figure 1]d (GBM-NOS: 45; GBM-G: 1; GBM-E: 1; GS: 1; GBM-S: 1; GBM-O: 6; age range, ≤30 years: 10; 31–40 years: 11; 41–50 years: 13; 51–60 years: 7; >60 years: 14), focal positive in 34 cases (31–40 years: 7; 41–50 years: 4; 51–60 years: 12; >60 years: 11) and negative in 43 cases (≤30 years: 4; 31–40 years: 6; 41–50 years: 5; 51–60 years: 21; >60 years: 7). Two cases were interpreted as non-contributory as there were no cells with any amount of nuclear staining.

    No significant correlation was seen between p53 expression and ATRX expression (P - value, 0.192). A statistically significant correlation was seen between p53 over-expression (after grouping focal positive and negatives as non-positive group) and EGFR amplification status (P value 0.020). No significant correlation of p53 expression with ATRX was found even after combining the positives and focal positives as one group of p53 overexpression (P value, 0.598).

    The frequencies of histological and molecular parameters investigated in relation to morphological patterns are shown in [Table 1].
    Table 1: Frequency of histological and molecular parameters investigated in relation to morphological patterns

    Click here to view


    Correlation of MGMT status with clinico-pathological parameters [Table 2], [Table 3], [Table 4]
    Table 2: Patients' demographics in relation to molecular groups

    Click here to view
    Table 3: Frequency of the histological parameters investigated in relation to MGMT methylation status

    Click here to view
    Table 4: Frequency of the molecular alterations investigated in relation to MGMT promoter methylation status

    Click here to view


    The MGMT promoter methylation group (the combined group of methylation and low methylation) did not show statistically significant correlation with age (P - value, 0.969), sex (P - value, 0.91), or location (P - value, 0.56) [Table 2]. Confluent necrosis was noted in 55 of the 68 (80%) unmethylated cases vs 37 of the 66 (56%) methylated cases. The odds of MGMT unmethylation were three times more in the presence of confluent necrosis (OR, 3.3; CI, 1.5–7.2), with statistical significance (P - value, 0.002). Pseudo-palisading necrosis was seen in 8/66 (11.4%) of methylated and 14/68 (26.4%) of unmethylated cases and was not statistically significant (P - value, 0.18). Six of 66 (9%) methylated and 9/68 (13%) of unmethylated cases showed calcification with no significant correlation between them (P - value, 0.45) [Table 3].

    MGMT methylation status was significantly associated with IDH1R132H mutation (OR, 4.3; CI, 1.3–13.8; P - value, 0.01). Seventy-four percent (14/18) of IDH1R132H mutated cases were methylated. The frequency of IDH1R132H mutation was 21% (14/66) and 5.8% (4/68) in the methylated and unmethylated groups, respectively.

    ATRX loss was seen in 15/66 (23%) of the methylated and 5/68 (7.3%) of the unmethylated cases. There was a statistical significant correlation between MGMT methylation and ATRX loss (OR, 4.0; CI, 1.3–11.8; P - value 0.01).

    The frequency of p53 protein over-expression was 40% in both methylated and unmethylated groups with no correlation between them (P - value, 0.86).

    EGFR amplification was seen in 13 of 66 (20%) of methylated vs 14/68 (20.5%) of unmethylated cases. There was no significant correlation between MGMT methylation status and EGFR amplification (OR, 0.85; CI, 0.3–2.0; P - value, 0.71) [Table 4].

    Statistical analysis to test the association between the MGMT methylation status with clinico-pathological parameters was also carried out after excluding the 14 LM cases from the methylated group. A significant association of MGMT unmethylation was seen with confluent necrosis (P - value, 0.001); while methylation was observed for IDHR132H mutation (P - value, 0.01), and ATRX loss (P - value, 0.03). However, no significant association was seen with age, sex, location, pseudo-palisading necrosis, calcification, p53 expression, or EGFR amplification.

    Logistic regression analysis

    On univariable logistic regression analysis, only four variables – IDHR132H mutation, ATRX expression, confluent necrosis, and pseudo-palisading necrosis had a P - value of <0.20, and hence, were included as covariates in multivariable logistic regression analysis [Table 5].
    Table 5: Univariable and multivariable logistic regression

    Click here to view


    Multivariable logistic regression revealed only the presence of confluent necrosis as an independent predictor of MGMT unmethylation status (OR, 2.5; CI, 1.0–5.8; P - value, 0.04) [Table 5].


     » Discussion Top


    MGMT promoter methylation in GBM is one of the prognostic and clinical trial proven predictive biomarkers for chemoradiation.[1],[7] The MGMT gene is located at chromosome 10q26 and encodes a DNA repair enzyme, which is regulated by methylation-dependent epigenetic silencing mechanisms. Its promoter contains TATA-less and CAAT-less 777-bp 97 CpG (short 300-3000bp stretches of C-G rich regions) sites, which are usually unmethylated in normal tissues. Methyl CpG binding proteins bind to aberrantly methylated sequences on CpG islands, leading to condensation of chromatin and prevent the binding of transcriptional machinery, thus inhibiting the process of gene transcription (gene silencing).[7],[8] Nakagawachi et al., and Everhard et al., in their work on identification of regions correlating MGMT promoter methylation and gene expression in GBM, have demonstrated two regions in the promoter that are prone to high levels of methylation, one of which is the enhancer region. Methylation occurring at this region is more critical for the loss of MGMT gene expression; therefore, most methylation-specific tests are designed to target this region.[9],[10] In the present study also, the MGMT promoter methylation evaluation was based on primers targeting the same region.

    Several methods have been used for the assessment of MGMT methylation. MSP, the most commonly used technology, to date is the only test that has repeatedly been shown to be of predictive or prognostic value in different clinical trials.[11],[12],[13],[14],[15],[16],[17] It allows the evaluation of methylation status at six to nine CpG sites.[13],[14],[18] When well-optimized, the method delivers easy-to-interpret results, and the gel-based detection does not require expensive equipment. However, the disadvantages include the conduction of a non-quantitative technique, a lower number of assessable CpG dinucleotides, and a relative lack of or no control for bisulfite conversion, and hence, incomplete conversion of unmethylated cytosines may be interpreted as methylation, leading to false-positive results.[8] However, in the present study, all reactions were run with appropriate positive and negative controls, with many of them run in duplicates with reproducible results.

    Other quantitative and semiquantitative techniques with unique advantages have also been used. qPCR, a sensitive and specific technique, allows higher levels of standardization and lacks definition of cut-offs for methylation, as the percentage of contaminating stromal cells cannot be accurately assessed.[19] Pyrosequencing and bisulfite sequencing are currently regarded as the gold standard as they provide single base pair resolution and quantitative methylation information but are cost and labor intensive.[20] However, the clinical significance of detection of such low levels of methylation was always questionable. Combined bisulfite restriction analysis (COBRA) utilizes restriction enzymes that differentiate between methylated and unmethylated sequences.[20] Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is fast gaining popularity as it does not require bisulfate modification.[21] Methyl-specific high-resolution melting analysis (MS-HRM) evaluates large regions. Bead arrays, mass spectroscopy, and denaturing high-performance liquid chromatography are some of the other available techniques.[22],[23],[24],[25]

    No concordance between MGMT IHC and MGMT methylation (by MSP) and patient survival has been reported.[26],[27],[28] The reasons include lack of reproducibility among neuropathologists, lack of cut-off values, tumor heterogeneity, and admixture of MGMT expressing non-neoplastic cells.[29] At present, IHC is not the method of choice for the detection of MGMT methylation and should be discouraged in clinical practice.

    The frequency rates of MGMT methylation by MSP varies from as low as 35% to as high as 68% in various studies.[11],[12],[15],[16],[30],[31],[32],[33],[34] The frequency of methylation detected by other techniques ranges from 26% to 80% (pyrosequencing 53–67%; qMSP 24–69%; MS-MLPA 58–80%, COBRA 41%, bead arrays 38–60%).[9],[17],[22],[27],[34],[35],[36],[37],[38],[39] The frequency of methylation in our study by MS-PCR was 49.2%.

    There was no significant difference in the median age (51.5 years; range 21–75 years vs 51.5 years; range 20–74 years) between the methylated and unmethylated groups in our study and there was also no significant correlation with gender (P - value, 0.91).

    Eoli et al., in their study of 86 GBMs, have shown a correlation between the MGMT promoter methylation status and tumor location. GBMs with MGMT methylation were preferentially located in the parietal and occipital lobes and unmethylated cases were located in the temporal lobe.[30] In our study, 44% of the methylated cases were located in the frontal lobe, and 47% of unmethylated cases were located in the temporal lobe. Compared to the frontal lobe (taken as the baseline for comparison of odds ratio (OR) of other sites in the study relative to the baseline), MGMT unmethylated cases were 2.2 times more commonly located in the temporal lobe (OR, 2.2; confidence interval [CI], 1.0–4.8), however, with borderline statistical significance (P - value, 0.05).

    Necrosis is the hallmark of GBM and indicates rapid growth and malignant behavior. It is a significant independent prognostic factor that negatively affects progression-free survival. Eoli et al., in their study of 86 GBMs, observed that necrosis was present in 67.5% of unmethylated cases and 32% of methylated cases, with a significant association between MGMT unmethylation and necrosis.[30] In our study also, a significant association was seen between MGMT unmethylation and confluent necrosis (P - value, 0.002; CI, 1.5–7.2). On multivariable logistic regression, confluent necrosis was found to be an independent predictor of MGMT promoter unmethylation status (OR, 2.5; CI, 1.0–5.8; P - value, 0.04). However, no significant correlation was seen with pseudo-palisading necrosis or calcification.

    Mutational analysis of GBM has revealed somatic mutations of IDH1 gene in 12% of GBMs.[40] Sanson et al., found a statistical significant correlation between MGMT methylation and IDH1 mutation in 194 gliomas.[41] However Jha et al., and Suri et al., did not find any statistical correlation between MGMT methylation and IDH1 mutation in GBMs.[33],[34] Jha et al., found the frequency of IDH 1 mutation in 4.8% and 6.7% tumors in methylated and unmethylated GBM groups, respectively. Felsberg et al., and Weller et al., also did not find any significant correlation between the two in their series.[16],[42] The frequency of IDH1R132H mutation in our study was 13.4% and was significantly associated with MGMT methylation status (OR, 4.3; CI, 1.3–13.8; P - value, 0.01). However, the present study is limited by lack of data on other IDH1/2 mutations, which would have been more relevant.

    Three cases of GBM (two frontal and one parietal) with IDHR132H mutation retained ATRX expression and non-amplified EGFR were re-reviewed and histologically they were unequivocal GBMs. No oligodendroglial morphology was identified. However, the characteristics of these tumors are limited by the lack of 1p19q deletion data.

    The German NOA-04 trial (NCT00717210) correlating IDH mutations and MGMT promoter methylation with ATRX expression found that ATRX loss occurred almost exclusively in tumors harboring IDH mutations (42/98 IDH mutated tumors). Furthermore, no association between MGMT promoter methylation and ATRX loss was observed.[43] In our study, ATRX loss was seen in 15% of GBMs and correlated significantly with MGMT promoter methylation status (OR, 4.0; CI, 1.3–11.8; P - value, 0.01).

    The incidence of p53 protein accumulation is more frequently seen than p53 mutations, and the over-expression of p53 in GBM is often associated with the presence of p53 mutations.[44] Studies on the association of MGMT promoter methylation with EGFR amplification and p53 mutation are highly contradicting. Shamshara et al., and Lofti et al., reported a statistically significant correlation between MGMT promoter methylation and p53 mutations in GBMs.[45] However, Jesien-Lewandowicz et al., in their study of 32 primary GBMs did not find any significant correlation.[46] In our study, p53 positivity was the same (40%) in the methylated and unmethylated groups with no statistical significant association between p53 expression and MGMT methylation (P - value, 0.86).

    Eoli et al., found EGFR amplification to be more frequent in unmethylated than in methylated GBMs (40% vs. 28%) though the difference was not statistically significant.[30] Jha et al., found EGFR amplification in 30.4% of methylated GBMs and in 42.1% of unmethylated GBMs with no significant association.[33] In our study, the frequency of EGFR amplification in methylated and unmethylated groups was relatively similar (20% and 20.5%, respectively) with no significant association between them (P - value, 0.71).

    Hegi et al., in the EORTC/NCIC phase III trial established that MGMT methylated patients lived longer, irrespective of the treatment. The median overall survival among patients with methylation was 18.2 months compared with 12.2 months among those without methylation. A 5-year analysis of the same study demonstrated that MGMT methylation is the strongest predictor for outcome and benefit from temozolomide (TMZ) chemotherapy.[47] The Radiation Therapy Oncology Group (RTOG) 0525 study in GBM showed that MGMT methylation confers benefit in terms of progression-free survival and overall survival. Other studies have also validated the same findings. In the present study, as the follow-up data available is too short, statistical correlation of MGMT methylation with survival has not been done.

    To summarize, the frequency of MGMT promoter methylation in GBMs in our study was 49.2%, which was significantly associated with IDHR132H mutation and ATRX loss. In addition, the presence of confluent necrosis was significantly associated with MGMT unmethylation and was found to be an independent predictor of the same. The frequency of methylation in the frontal location is higher compared to other cerebral hemispheric locations.

    Acknowledgments

    The authors acknowledge Dr. Salma Ayis, King's College London, for the statistical advice.

    Financial support and sponsorship

    Nil.

    Conflicts of interest

    There are no conflicts of interest.



     
     » References Top

    1.
    Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJB, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987-96.  Back to cited text no. 1
        
    2.
    Patel M, Vogelbaum MA, Barnett GH, Jalali R, Ahluwalia MS. Molecular targeted therapy in recurrent glioblastoma: Current challenges and future directions. Expert Opin Investig Drugs 2012;21:1247-66.  Back to cited text no. 2
        
    3.
    Brandner S, von Deimling A. Diagnostic, prognostic and predictive relevance of molecular markers in gliomas. Neuropathol Appl Neurobiol 2015;41:694-720.  Back to cited text no. 3
        
    4.
    Karsy M, Neil JA, Guan J, Mark MA, Colman H, Jensen RL. A practical review of prognostic correlations of molecular biomarkers in glioblastoma. Neurosurg Focus 2015;38:E4.  Back to cited text no. 4
        
    5.
    McNamara MG, Sahebjam S, Mason WP. Emerging biomarkers in glioblastoma. Cancers 2013;5:1103-19.  Back to cited text no. 5
        
    6.
    Shelly D, Epari S, Arora I, Pai T, Ahmed S, Moiyadi A, et al. Epidermal growth factor receptor (EGFR) gene amplification in high-grade gliomas: Western Indian tertiary cancer center experience. Neurol India 2016;64:115-20.  Back to cited text no. 6
    [PUBMED]  [Full text]  
    7.
    Weller M, Stupp R, Reifenberger G, Brandes AA, van den Bent MJ, Wick W, et al. MGMT promoter methylation in malignant gliomas: Ready for personalized medicine? Nat Rev Neurol 2010;6:39-51.  Back to cited text no. 7
        
    8.
    Cankovic M, Nikiforova MN, Snuderl M, Adesina AM, Lindeman N, Wen PY, et al. The role of MGMT testing in clinical practice: A report of the association for molecular pathology. J Mol Diagn JMD 2013;15:539-55.  Back to cited text no. 8
        
    9.
    Nakagawachi T, Soejima H, Urano T, Zhao W, Higashimoto K, Satoh Y, et al. Silencing effect of CpG island hypermethylation and histone modifications on O6-methylguanine-DNA methyltransferase (MGMT) gene expression in human cancer. Oncogene 2003;22:8835-44.  Back to cited text no. 9
        
    10.
    Everhard S, Tost J, El Abdalaoui H, Crinière E, Busato F, Marie Y, et al. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas. Neuro-Oncol 2009;11:348-56.  Back to cited text no. 10
        
    11.
    Hegi ME, Diserens A-C, Godard S, Dietrich P-Y, Regli L, Ostermann S, et al. Clinical trial substantiates the predictive value of O-6-methylguanine-DNA methyltransferase promoter methylation in glioblastoma patients treated with temozolomide. Clin Cancer Res Off J Am Assoc Cancer Res 2004;10:1871-4.  Back to cited text no. 11
        
    12.
    Herrlinger U, Rieger J, Koch D, Loeser S, Blaschke B, Kortmann R-D, et al. Phase II trial of lomustine plus temozolomide chemotherapy in addition to radiotherapy in newly diagnosed glioblastoma: UKT-03. J Clin Oncol 2006;24:4412-7.  Back to cited text no. 12
        
    13.
    Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 1999;59:793-7.  Back to cited text no. 13
        
    14.
    Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB. Methylation-specific PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93:9821-6.  Back to cited text no. 14
        
    15.
    Hegi ME, Diserens A-C, Gorlia T, Hamou M-F, de Tribolet N, Weller M, et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med 2005;352:997-1003.  Back to cited text no. 15
        
    16.
    Weller M, Felsberg J, Hartmann C, Berger H, Steinbach JP, Schramm J, et al. Molecular predictors of progression-free and overall survival in patients with newly diagnosed glioblastoma: A prospective translational study of the German Glioma Network. J Clin Oncol 2009;27:5743-50.  Back to cited text no. 16
        
    17.
    Gorlia T, van den Bent MJ, Hegi ME, Mirimanoff RO, Weller M, Cairncross JG, et al. Nomograms for predicting survival of patients with newly diagnosed glioblastoma: Prognostic factor analysis of EORTC and NCIC trial 26981-22981/CE.3. Lancet Oncol 2008;9:29-38.  Back to cited text no. 17
        
    18.
    Cankovic M, Mikkelsen T, Rosenblum ML, Zarbo RJ. A simplified laboratory validated assay for MGMT promoter hypermethylation analysis of glioma specimens from formalin-fixed paraffin-embedded tissue. Lab Investig J Tech Methods Pathol 2007;87:392-7.  Back to cited text no. 18
        
    19.
    Vlassenbroeck I, Califice S, Diserens A-C, Migliavacca E, Straub J, Di Stefano I, et al. Validation of real-time methylation-specific PCR to determine O6-methylguanine-DNA methyltransferase gene promoter methylation in glioma. J Mol Diagn JMD 2008;10:332-7.  Back to cited text no. 19
        
    20.
    Mikeska T, Bock C, El-Maarri O, Hübner A, Ehrentraut D, Schramm J, et al. Optimization of quantitative MGMT promoter methylation analysis using pyrosequencing and combined bisulfite restriction analysis. J Mol Diagn JMD 2007;9:368-81.  Back to cited text no. 20
        
    21.
    Jeuken JWM, Cornelissen SJB, Vriezen M, Dekkers MMG, Errami A, Sijben A, et al. MS-MLPA: An attractive alternative laboratory assay for robust, reliable, and semiquantitative detection of MGMT promoter hypermethylation in gliomas. Lab Investig J Tech Methods Pathol 2007;87:1055-65.  Back to cited text no. 21
        
    22.
    Wojdacz TK, Dobrovic A. Methylation-sensitive high resolution melting (MS-HRM): A new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res 2007;35:e41.  Back to cited text no. 22
        
    23.
    Martinez R, Martin-Subero JI, Rohde V, Kirsch M, Alaminos M, Fernandez AF, et al. A microarray-based DNA methylation study of glioblastoma multiforme. Epigenetics 2009;4:255-64.  Back to cited text no. 23
        
    24.
    Coolen MW, Statham AL, Gardiner-Garden M, Clark SJ. Genomic profiling of CpG methylation and allelic specificity using quantitative high-throughput mass spectrometry: Critical evaluation and improvements. Nucleic Acids Res 2007;35:e119.  Back to cited text no. 24
        
    25.
    Ezzeldin HH, Lee AM, Mattison LK, Diasio RB. Methylation of the DPYD promoter: An alternative mechanism for dihydropyrimidine dehydrogenase deficiency in cancer patients. Clin Cancer Res 2005;11(24 Pt 1):8699-705.  Back to cited text no. 25
        
    26.
    Cao VT, Jung T-Y, Jung S, Jin S-G, Moon K-S, Kim I-Y, et al. The correlation and prognostic significance of MGMT promoter methylation and MGMT protein in glioblastomas. Neurosurgery 2009;65:866-75; discussion 875.  Back to cited text no. 26
        
    27.
    Preusser M, Charles Janzer R, Felsberg J, Reifenberger G, Hamou M-F, Diserens A-C, et al. Anti-O6-methylguanine-methyltransferase (MGMT) immunohistochemistry in glioblastoma multiforme: Observer variability and lack of association with patient survival impede its use as clinical biomarker. Brain Pathol Zurich Switz 2008;18:520-32.  Back to cited text no. 27
        
    28.
    Maxwell JA, Johnson SP, Quinn JA, McLendon RE, Ali-Osman F, Friedman AH, et al. Quantitative analysis of O6-alkylguanine-DNA alkyltransferase in malignant glioma. Mol Cancer Ther 2006;5:2531-9.  Back to cited text no. 28
        
    29.
    Sasai K, Nodagashira M, Nishihara H, Aoyanagi E, Wang L, Katoh M, et al. Careful exclusion of non-neoplastic brain components is required for an appropriate evaluation of O6-methylguanine-DNA methyltransferase status in glioma: Relationship between immunohistochemistry and methylation analysis. Am J Surg Pathol 2008;32:1220-7.  Back to cited text no. 29
        
    30.
    Eoli M, Menghi F, Bruzzone MG, De Simone T, Valletta L, Pollo B, et al. Methylation of O6-methylguanine DNA methyltransferase and loss of heterozygosity on 19q and/or 17p are overlapping features of secondary glioblastomas with prolonged survival. Clin Cancer Res 2007;13:2606-13.  Back to cited text no. 30
        
    31.
    Brandes AA, Franceschi E, Tosoni A, Blatt V, Pession A, Tallini G, et al. MGMT promoter methylation status can predict the incidence and outcome of pseudoprogression after concomitant radiochemotherapy in newly diagnosed glioblastoma patients. J Clin Oncol 2008;26:2192-7.  Back to cited text no. 31
        
    32.
    Wick W, Stupp R, Beule A-C, Bromberg J, Wick A, Ernemann U, et al. A novel tool to analyze MRI recurrence patterns in glioblastoma. Neuro-Oncol 2008;10:1019-24.  Back to cited text no. 32
        
    33.
    Jha P, Suri V, Jain A, Sharma MC, Pathak P, Jha P, et al. O 6-methylguanine DNA methyltransferase gene promoter methylation status in gliomas and its correlation with other molecular alterations:First Indian report with review of challenges for use in customized treatment. Neurosurgery 2010;67:1681-91.  Back to cited text no. 33
        
    34.
    Suri V, Jha P, Sharma MC, Sarkar C. O 6-methylguanine DNA methyltransferase gene promoter methylation in high-grade gliomas: A review of current status. Neurol India 2011;59:229-35.  Back to cited text no. 34
    [PUBMED]  [Full text]  
    35.
    Dunn J, Baborie A, Alam F, Joyce K, Moxham M, Sibson R, et al. Extent of MGMT promoter methylation correlates with outcome in glioblastomas given temozolomide and radiotherapy. Br J Cancer 2009;101:124-31.  Back to cited text no. 35
        
    36.
    Crinière E, Kaloshi G, Laigle-Donadey F, Lejeune J, Auger N, Benouaich-Amiel A, et al. MGMT prognostic impact on glioblastoma is dependent on therapeutic modalities. J Neurooncol 2007;83:173-9.  Back to cited text no. 36
        
    37.
    Laffaire J, Everhard S, Idbaih A, Crinière E, Marie Y, de Reyniès A, et al. Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis. Neuro-Oncol 2011;13:84-98.  Back to cited text no. 37
        
    38.
    Rivera AL, Pelloski CE, Gilbert MR, Colman H, De La Cruz C, Sulman EP, et al. MGMT promoter methylation is predictive of response to radiotherapy and prognostic in the absence of adjuvant alkylating chemotherapy for glioblastoma. Neuro-Oncol 2010;12:116-21.  Back to cited text no. 38
        
    39.
    Van den Bent MJ, Dubbink HJ, Sanson M, van der Lee-Haarloo CR, Hegi M, Jeuken JWM, et al. MGMT promoter methylation is prognostic but not predictive for outcome to adjuvant PCV chemotherapy in anaplastic oligodendroglial tumors: A report from EORTC Brain Tumor Group Study 26951. J Clin Oncol 2009;27:5881-6.  Back to cited text no. 39
        
    40.
    Cohen AL, Holmen SL, Colman H. IDH1 and IDH2 mutations in gliomas. Curr Neurol Neurosci Rep 2013;13:345.  Back to cited text no. 40
        
    41.
    Sanson M, Marie Y, Paris S, Idbaih A, Laffaire J, Ducray F, et al. Isocitrate dehydrogenase 1 codon 132 mutation is an important prognostic biomarker in gliomas. J Clin Oncol 2009;27:4150-4.  Back to cited text no. 41
        
    42.
    Felsberg J, Wolter M, Seul H, Friedensdorf B, Göppert M, Sabel MC, et al. Rapid and sensitive assessment of the IDH1 and IDH2 mutation status in cerebral gliomas based on DNA pyrosequencing. Acta Neuropathol (Berl) 2010;119:501-7.  Back to cited text no. 42
        
    43.
    Wiestler B, Capper D, Holland-Letz T, Korshunov A, von Deimling A, Pfister SM, et al. ATRX loss refines the classification of anaplastic gliomas and identifies a subgroup of IDH mutant astrocytic tumors with better prognosis. Acta Neuropathol (Berl) 2013;126:443-51.  Back to cited text no. 43
        
    44.
    Nagpal J, Jamoona A, Gulati ND, Mohan A, Braun A, Murali R, et al. Revisiting the role of p53 in primary and secondary glioblastomas. Anticancer Res 2006;26:4633-9.  Back to cited text no. 44
        
    45.
    Shamsara J, Sharif S, Afsharnezhad S, Lotfi M, Raziee HR, Ghaffarzadegan K, et al. Association between MGMT promoter hypermethylation and p53 mutation in glioblastoma. Cancer Invest 2009;27:825-9.  Back to cited text no. 45
        
    46.
    Jesien-Lewandowicz E, Jesionek-Kupnicka D, Zawlik I, Szybka M, Kulczycka-Wojdala D, Rieske P, et al. High incidence of MGMT promoter methylation in primary glioblastomas without correlation with TP53 gene mutations. Cancer Genet Cytogenet 2009;188:77-82.  Back to cited text no. 46
        
    47.
    Hegi ME, Liu L, Herman JG, Stupp R, Wick W, Weller M, et al. Correlation of O 6-methylguanine methyltransferase (MGMT) promoter methylation with clinical outcomes in glioblastoma and clinical strategies to modulate MGMT activity. J Clin Oncol 2008;26:4189-99.  Back to cited text no. 47
        


        Figures

      [Figure 1], [Figure 2]
     
     
        Tables

      [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



     

    Top
    Print this article  Email this article
       
    Online since 20th March '04
    Published by Wolters Kluwer - Medknow