Atormac
Neurology India
Open access journal indexed with Index Medicus
  Users online: 2356  
 Home | Login 
About Editorial board Articles NSI Publications Search Instructions Online Submission Subscribe Videos Etcetera Contact
  Navigate Here 
 Search
 
  
 Resource Links
  »  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
  »  Article in PDF (1,023 KB)
  »  Citation Manager
  »  Access Statistics
  »  Reader Comments
  »  Email Alert *
  »  Add to My List *
* Registration required (free)  

 
  In this Article
 »  Abstract
 »  Materials and Me...
 » Results
 » Discussion
 » Conclusion
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed120    
    Printed2    
    Emailed0    
    PDF Downloaded25    
    Comments [Add]    

Recommend this journal

 


 
Table of Contents    
ORIGINAL ARTICLE
Year : 2018  |  Volume : 66  |  Issue : 6  |  Page : 1649-1654

Genetic analysis of the glucocerebrosidase gene in South Indian patients with Parkinson's disease


1 Department of Neurology, National Institute of Mental Health and Neurosciences (NIMHANS), Bangalore, Karnataka, India
2 Department of Molecular Reproduction, Development and Genetics, Indian Institute of Sciences, Bangalore, Karnataka, India

Date of Web Publication28-Nov-2018

Correspondence Address:
Dr. Arun Kumar
Department of Molecular Reproduction, Development and Genetics, Laboratory GE12, New Biological Sciences Building, Indian Institute of Science, Bangalore - 560 012, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0028-3886.246249

Rights and Permissions

 » Abstract 


Background: Mutations in the glucocerebrosidase (GBA) gene have been associated with Parkinson's disease (PD). Several variants in the gene have been identified as risk factors for the development of PD, but there is difference in the prevalence of this mutation in various ethnic groups and countries. There is no published study related to this field on the Indian population.
Aims and Objectives: The aim of the study was to investigate the frequency of mutations in the GBA gene in Indian patients with PD.
Materials and Methods: To perform the mutation analysis of the GBA gene, we amplified its entire coding region, spanning 11 exons and intron/exon junctions in three fragments, with a set of three primer pairs using the long polymerase chain reaction enzyme mix from Fermentas, Canada.
Results: We screened a total of 100 PD patients for mutations in the GBA gene. The sequence analysis identified the following five variants in this gene: IVS1 + 191G > C, IVS4 + 47G > A (rs. 2075569), IVS6 − 86A > G (rs. 114099990), IVS9 + 141A > G (rs. 28373017), and IVS10 + 3G > A. Of these, two variants IVS1 + 191G > C and IVS10 + 3G > A are novel, and the remaining three are known variants reported in the Single Nucleotide Polymorphism database (dbSNP). All the known variants were detected in homozygous as well as in heterozygous states. Both novel variants were identified in only one patient in a heterozygous state.
Conclusion: GBA mutation may not be so common in Indian patients with PD as compared to the other ethnic populations. These findings need to be confirmed in larger studies.


Keywords: Glucocerebrosidase, genetics, glucocerebrosidase mutation, India, Parkinson's disease
Key Message: Mutations in glucocerebrosidase (GBA) gene are associated with Parkinson's disease (PD). 100 Indian patients with PD were screened for mutations in the GBA gene. The sequence analysis identified five variants of GBA gene. Two of these variants, IVS1 + 191G > C and IVS10 + 3G > A, were novel while three other variants were known variants report in the Single Nucleotide Polymorphism database. None of these variants are, however, pathogenic. The presence of GBA mutations is unlikely to be a risk factor for Indian patients with PD.


How to cite this article:
Yadav R, Kapoor S, Madhukar M, Naduthota RM, Kumar A, Pal PK. Genetic analysis of the glucocerebrosidase gene in South Indian patients with Parkinson's disease. Neurol India 2018;66:1649-54

How to cite this URL:
Yadav R, Kapoor S, Madhukar M, Naduthota RM, Kumar A, Pal PK. Genetic analysis of the glucocerebrosidase gene in South Indian patients with Parkinson's disease. Neurol India [serial online] 2018 [cited 2018 Dec 19];66:1649-54. Available from: http://www.neurologyindia.com/text.asp?2018/66/6/1649/246249




Parkinson's disease (PD) is the second most common neurodegenerative disease after Alzheimer's disease.[1] Although PD is, by the whole, a multi-factorial disorder, approximately 5–10% of cases are known to have Mendelian (mono-genic) inheritance.[2] Several studies have found mutations in the glucocerebrosidase (GBA) gene in PD patients from different countries.[3],[4],[5],[6],[7],[8],[9],[10],[11],[12],[13],[14],[15],[16],[17],[18],[19],[20],[21],[22],[23] The loss-of-function mutations in the GBA gene are known to cause an autosomal recessive glycolipid storage disorder, Gaucher disease (GD), which is characterized by multi-system manifestations, including the involvement of the liver, spleen, bone marrow, lungs, and the nervous system.[24] However, there is no report of participation of the GBA gene in the pathophysiology of PD in patients from India. Many studies have, however, confirmed the association of GBA mutations with PD, up to a variable degree in the different ethnic groups.[17],[25]

The rationale of this study was to assess the involvement of the GBA gene in the pathophysiology of PD patients from India visiting the PD clinic at National Institute of Mental Health and Neurosciences (NIMHANS), Bengaluru, Karnataka. As the Indian population is quite different regarding their ethnicity compared to other countries, we had hypothesized that the range and types of GBA mutations are different in patients from India.


 » Materials and Methods Top


Patients with PD, either newly diagnosed or those who are being followed up at the neurology services at NIMHANS, were recruited for the study. The diagnosis of PD was made by a movement disorder specialist using the United Kingdon Parkinson's disease (UKPDS) criteria. The patients underwent a detailed neurological evaluation. After obtaining the informed consent from the patients, 3–5 ml of peripheral blood sample was collected from each of the patients, parents (if available), healthy and affected siblings (if possible) in sodium ethylenediaminetetraacetate (Na-EDTA)-Vacutainer (trade mark) tubes. The collected blood samples were stored in a refrigerator and then transferred to the Arun Kumar Laboratory at the Indian Institute of Science (IISc), Bengaluru, India.

To perform the mutation analysis of the GBA (beta-glucocerebrosidase) gene, the gene was amplified in its entire coding region spanning 11 exons and intron/exon junctions in three fragments (Fragments 1, 2, and 3) with a set of three primer pairs [Figure 1] and [Table 1] as described by Lesage et al., using the long polymerase chain reaction (PCR) enzyme mix from Fermentas, Canada.[26] We used this approach as our earlier attempt to amplify all the 11 coding GBA exons individually, using conventional Taq DNA polymerase, resulted in the amplification of mixed PCR products from both the GBA and GBAP (pseudo-GBA) genes. The agarose gel pictures of three fragments amplified are given in [Figure 2] (upper panel). These three fragments (viz., Fragments 1, 2, and 3) were then sequenced using exon-specific primers as detailed in [Table 1].
Figure 1: Chromosome location and genomic structure of the GBA gene. The location of a GBA ggg pseudogene, GBAP, which lies approximately 16 kb downstream of GBA, is also shown. Thick arrows represent primers for the amplification of the GBA gene into three fragments, and thin arrows represent the sequencing primers. Chromosome 1 ideogram from the UCSC bioinformatics site

Click here to view
Table 1: Details of amplification and sequencing primers used for the mutation analysis of the GBA gene

Click here to view
Figure 2: Mutation analysis of the GBA gene. Upper panel: Primer optimization for Fragments 1, 2, and 3 of the GBA gene. Abbreviations: L, 3 kb DNA ladder; NT, no template; and T, template DNA. Lower panel: Sequencing chromatograms from PD patients. Thick arrows in sequencing chromatograms mark the nucleotide changes

Click here to view


Mutation analysis of the GBA gene in Parkinson's disease patients

For mutation analysis, total genomic deoxyribose nucleic acid (DNA) was isolated from 3 to 5 ml of a blood sample from each patient using a Wizard Genomic DNA Purification kit (Promega, USA). The entire coding region of the GBA gene located on chromosome 1q21 was amplified using primers that amplified all 11 coding exons and their intron/exon junctions. Primers were designed using the gene sequence from the University of California Santa Cruz (UCSC) Bioinformatics site. Mutations were identified by sequencing PCR products from affected individuals, using an ABI Prism A370-automated sequencer (PE Biosystems, USA). The following criteria were used to designate a particular DNA change as a mutation: (1) its absence in 300 controls, (2) a change occurring at an amino acid position which is conserved across species, and (3) it leads to a deleterious effect on the protein. Allele-specific polymerase chain reaction (PCR) was used to determine if a change is present in approximately 100 control chromosomes.

The study was approved by the Ethics Committee of both the institutes (NIMHANS and IISc).


 » Results Top


A total of 100 patients with PD (mean age: 55.18 ± 12.63 years, range: 20–75 years, median duration of PD: 3 years) were analyzed. A positive family history of PD was present in 16 patients (16%). Sixty-seven patients were on dopaminergic medications and the rest were on trihexyphenidyl, propranolol, or both, at the time of recruitment. The entire coding region, including intron/exon junctions, of the GBA gene, was sequenced to find mutations in 100 PD patients. No GBA mutation was identified in these patients. However, the sequence analysis identified the following five variants in this gene: IVS1 + 191G > C, IVS4 + 47G > A (rs. 2075569), IVS6 − 86A > G (rs. 114099990), IVS9 + 141A > G (rs. 28373017), and IVS10 + 3G > A. Of these two variants, IVS1 + 191G > C and IVS10 + 3G > A are novel, and the remaining three are known variants reported in the dbSNP database. All the known variants were detected in homozygous as well as in heterozygous states. Both novels variants were identified in single patients in a heterozygous state [Table 2]. We wanted to test if the IVS10 + 3G > A variant observed in the patient PK-8 leads to a splicing defect as it was closer to the donor splice site in intron 10. In this direction, we isolated total ribonucleic acid (RNA) from the peripheral blood of this patient, made cDNA, and performed real-time PCR (RT-PCR). As can be seen in [Figure 3], this variant did not cause a splicing defect. There were 42 controls (mean age: 49 ± 10 years, age range: 28–67 years) in this study.
Table 2: GBA variants identified in patients with Parkinson's disease during the present study

Click here to view
Figure 3: RT-PCR analysis of the patient PK-8. Total RNA isolated from peripheral blood was reverse transcribed and used as a template. Note, an expected size band of 348 bp (arrow), suggesting that the IVS10 + 3G > A variant does not cause the splicing defect. PCR was performed using the following primers: IVS10 + 3G > A variant does not cause splicing defect. PCR was performed using following primers: GBA-RTF: 5′GACTGGAACCTTGCCCTGAAC3′, and GBA-RTR: 5′ACGCCACAGGTAGGTGTGAATG3′

Click here to view


There was one patient with one novel (IVS1 + 191G > C), and three known variants (IVS4 + 47G > A, IVS6 – 86A > G, and IVS9 + 141A > G). Sixty-four patients had three known variants (IVS4 + 47 G > A, IVS6-86 A > G, and IVS9 + 141 A > G), one patient had two known variants (IVS6-86 A > G, IVS9 + 141 A > G) and one had one novel variant (IVS9 + 141 A > G) [Table 2]. Of these patients, 15 had young onset PD and 16 had a positive family history of PD.


 » Discussion Top


In this case–control study, we tried to ascertain the frequency of GBA mutations in Indian patients with PD. We did not find any mutation in our patient population. The presence of GBA mutations as a risk factor have been established by various studies across the world. Although GD is one of the common lysosomal storage disorders in India and abroad, the mutation could not be detected in the sample of patients in this study.[26],[27]

Indian studies

In the Indian population, GD is present and is considered as the most common lysosomal storage.[26] The mutation spectrum is similar to that seen in the other populations and L444P is one of the major mutations detected.[26],[27]

Asian studies on GBA

Ziegler et al., (2007) studied 92 PD patients from Taiwan and detected mutant alleles. They identified two mutations L444P and D409H and two novel mutations L174P and Q497R.[8] Sun et al., (2010) assessed L444p mutation in 402 Chinese PD patients and found a 2.74% (11/2014) detection rate. This mutation was considered as a risk factor for PD in the Chinese population.[17] Choi et al., (2012) studied the association between 277 PD patients and GBA mutations and found five different pathogenic heterozygous GBA mutations (N188S, P201H, R257Q, S271G, and L444P).[21] The mean age of these patients was less than that of the non-carriers.[21] Pulkes et al., (2014) from Thailand assessed the frequency and clinical features in a Thai cohort of 480 patients and 395 controls. Heterozygous mutations were identified in 24 patients (5%) and two controls. Of the seven identified GBA point mutations that comprised p.N386K, p. 428S, IVS2 + 1G > A, IVS9 + 3G > C, IVS10-9_10GT > AG, and c. 1309delG, five mutations were novel. GBA mutations were more frequent in the early onset PD. These patients also had a higher Hoehn and Yahr stage and a rapid progression of the disease.[28]

Li et al., (2014) sequenced the entire coding exons including the intron/exon junctions of GBA in 147 familial PD patients and 100 unrelated control subjects. 27 of the 144 (18.8%) index patients were heterozygous for known GD mutations. The frequency was significantly higher in autosomal dominant PD.[29]

Wu et al., (2007) did a case–control study in a cohort of 518 PD patients and 339 controls for the three common GBA mutations in Taiwan, that is, L444P, RecNciI and R120W using PCR-restriction enzyme assay and DNA sequencing. Heterozygous GBA mutations were detected in 16 PD patients (3.1%) and four controls (1.2%). This difference was statistically not significant, but the age of onset of these patients was younger than the total patient group by 10 years.[7] Hu et al., (2010) found that six patients with PD and two control subjects carried the GBA N370S allele out of 628 subjects in two separate cohorts in Chinese Han population.[14] Huang et al., (2011) studied 1747 participants: 967 PD patients and 780 healthy individuals in the HAN Chinese community. They screened the entire GBA coding regions and exon/intron boundaries in 30 randomly chosen PD patients, followed by testing of five variants (L444P, D409H, R120W, L174P, and Q497R) in all the participants. The G2385R and R1628P in LRRK2 had been previously studied in almost all the participants. In total, 36 patients (3.72%) carried a heterozygous mutant GBA allele (27 L444P, 7 RecNciI, and 2 D409H). Only two controls (0.26%) carried the heterozygous GBA mutation (1 L444P and 1 RecNciI). In the PD group, the mean age at onset in carriers was younger than in non-carriers.[18]

Studies on GBA from rest of the world

Kalinderi et al., (2009) studied 172 patients with PD from Greece by sequencing the whole GBA gene and found four mutations (L445P, D409H, E326K, and H255Q)) associated with GD/PD and five novel variants (R329H, L268L, S271G, T428K, and V460L). H255Q was the most common GBA mutation among Greek PD patients. Sato et al., (2005) studied 88 PD patients and found 5 PD cases with heterozygous mutations.[12]

Nichols et al., (2009) characterized sequence variation within the GBA gene in a select subset of 1325 cases of PD from 566 multiplex PD families and 359 controls. Nine different GBA variants, five previously reported, were identified in 21 out of 96 PD cases sequenced. There were 161 (12.2%) variant carriers. The presence of GBA variant was associated with an earlier age of onset (6 years earlier) than in those without it.[30] In PD population from Portugal, Bras et al., (2009) found GBA mutations in 6.1% subjects. However, Zhang et al., (2013) did not find any of these mutations in 61 PD patients.[11] Zhang et al., (2013) studied 312 PD patients from Portugal and sequenced the entire exon and intron/exon boundaries of LRRK2 and GBA. Screening of GBA revealed no mutations in 61 familial PD patients.[31] Bras et al., (2009) found GBA mutation in 6% of a total of 230 patients with PD in a population from Portugal.[11]


 » Conclusion Top


This is the first study focusing on the assessment of GBA gene in Indian patients with PD. It shows that as compared to other Asian countries such as China, Taiwan, South Korea, Thailand, and Japan, the GBA mutation may not be a significant risk factor for Indian patients with Parkinson's disease. Also, it highlights the need for a larger study among patients with sporadic and young onset PD in the Indian population to detect novel mutations that could be risk factors for PD.

Financial support and sponsorship

Department of Biotechnology, Government of India. Grant number BT/PR3935/MED/12/530/2011, Dated: 04.06.2012.

Conflicts of interest

There are no conflicts of interest.



 
 » References Top

1.
de Lau LM, Breteler MM. Epidemiology of Parkinson's disease. Lancet Neurol 2006;5:525-35.  Back to cited text no. 1
    
2.
Hernandez DG, Reed X, Singleton AB. Genetics in Parkinson disease: Mendelian versus non-Mendelian inheritance. J Neurochem 2016;139:59-74.  Back to cited text no. 2
    
3.
Aharon-Peretz J, Rosenbaum H, Gershoni-Baruch R. Mutations in the glucocerebrosidase gene and Parkinson's disease in Ashkenazi Jews. N Engl J Med 2004;351:1972-7.  Back to cited text no. 3
    
4.
Eblan MJ, Nguyen J, Ziegler SG, Lwin A, Hanson M, Gallardo M, et al. Glucocerebrosidase mutations are also found in subjects with early-onset parkinsonism from Venezuela. Mov Disord 2006;21:282-3.  Back to cited text no. 4
    
5.
Toft M, Pielsticker L, Ross OA, Aasly JO, Farrer MJ. Glucocerebrosidase gene mutations and Parkinson disease in the Norwegian population. Neurology 2006;66:415-7.  Back to cited text no. 5
    
6.
Tan EK, Tong J, Fook-Chong S, Yih Y, Wong MC, Pavnni R, et al. Glucocerebrosidase mutations and risk of Parkinson disease in Chinese patients. Arch Neurol 2007;64:1056-8.  Back to cited text no. 6
    
7.
Wu YR, Chen CM, Chao CY, Ro LS, Lyu RK, Chang KH, et al. Glucocerebrosidase gene mutation is a risk factor for early onset of Parkinson disease among Taiwanese. J Neurol Neurosurg Psychiatry 2007;78:977-9.  Back to cited text no. 7
    
8.
Ziegler SG, Eblan MJ, Gutti U, Hruska KS, Stubblefield BK, Goker-Alpan O, et al. Glucocerebrosidase mutations in Chinese subjects from Taiwan with sporadic Parkinson disease. Mol Genet Metab 2007;91:195-200.  Back to cited text no. 8
    
9.
De Marco EV, Annesi G, Tarantino P, Rocca FE, Provenzano G, Civitelli D, et al. Glucocerebrosidase gene mutations are associated with Parkinson's disease in southern Italy. Mov Disord 2008;23:460-3.  Back to cited text no. 9
    
10.
Spitz M, Rozenberg R, Pereira Lda V, Reis Barbosa E. Association between Parkinson's disease and glucocerebrosidase mutations in Brazil. Parkinsonism Relat Disord 2008;14:58-62.  Back to cited text no. 10
    
11.
Bras J, Paisan-Ruiz C, Guerreiro R, Ribeiro MH, Morgadinho A, Januario C, Sidransky E, et al. Complete screening for glucocerebrosidase mutations in Parkinson disease patients from Portugal. Neurobiol Aging 2009;30:1515-7.  Back to cited text no. 11
    
12.
Kalinderi K, Bostantjopoulou S, Paisan-Ruiz C, Katsarou Z, Hardy J, Fidani L. Complete screening for glucocerebrosidase mutations in Parkinson disease patients from Greece. Neurosci Lett 2009;452:87-9.  Back to cited text no. 12
    
13.
Socal MP, Bock H, Michelin-Tirelli K, Hilbig A, Saraiva-Pereira ML, Rieder CR, et al. Parkinson's disease and the heterozygous state for glucocerebrosidase mutations among Brazilians. Parkinsonism Relat Disord 2009;15:76-8.  Back to cited text no. 13
    
14.
Hu FY, Xi J, Guo J, Yu LH, Liu L, He XH, et al. Association of the glucocerebrosidase N370S allele with Parkinson's disease in two separate Chinese Han populations of mainland China. Eur J Neurol 2010;17:1476-8.  Back to cited text no. 14
    
15.
Mao XY, Burgunder JM, Zhang ZJ, An XK, Zhang JH, Yang Y, et al. Association between GBA L444P mutation and sporadic Parkinson's disease from Mainland China. Neurosci Lett 2010;469:256-9.  Back to cited text no. 15
    
16.
Nishioka K, Vilarino-Guell C, Cobb SA, Kachergus JM, Ross OA, Wider C, et al. Glucocerebrosidase mutations are not a common risk factor for Parkinson disease in North Africa. Neurosci Lett 2010;477:57-60.  Back to cited text no. 16
    
17.
Sun QY, Guo JF, Wang L, Yu RH, Zuo X, Yao LY, et al. Glucocerebrosidase gene L444P mutation is a risk factor for Parkinson's disease in Chinese population. Mov Disord 2010;25:1005-11.  Back to cited text no. 17
    
18.
Huang CL, Wu-Chou YH, Lai SC, Chang HC, Yeh TH, Weng YH, et al. Contribution of glucocerebrosidase mutation in a large cohort of sporadic Parkinson's disease in Taiwan. Eur J Neurol 2011;18:1227-32.  Back to cited text no. 18
    
19.
Lesage S, Condroyer C, Hecham N, Anheim M, Belarbi S, Lohman E, et al. French Parkinson disease genetic mutations in the glucocerebrosidase gene confer a risk for Parkinson disease in North Africa. Neurology 2011;76:301-3.  Back to cited text no. 19
    
20.
Moraitou M, Hadjigeorgiou G, Monopolis I, Dardiotis E, Bozi M, Vassilatis D, et al. beta-Glucocerebrosidase gene mutations in two cohorts of Greek patients with sporadic Parkinson's disease. Mol Genet Metab 2011;104:149-52.  Back to cited text no. 20
    
21.
Choi JM, Kim WC, Lyoo CH, Kang SY, Lee PH, Baik JS, et al. Association of mutations in the glucocerebrosidase gene with Parkinson disease in a Korean population. Neurosci Lett 2012;514:12-5.  Back to cited text no. 21
    
22.
Emelyanov A, Boukina T, Yakimovskii A, Usenko T, Drosdova A, Zakharchuk A, et al. Glucocerebrosidase gene mutations are associated with Parkinson's disease in Russia. Mov Disord 2012;27:158-9.  Back to cited text no. 22
    
23.
Kumar KR, Ramirez A, Gobel A, Kresojevic N, Svetel M, Lohmann K, et al. Glucocerebrosidase mutations in a Serbian Parkinson's disease population. Eur J Neurol 2013;20:402-5.  Back to cited text no. 23
    
24.
Bembi B, Zambito Marsala S, Sidransky E, Ciana G, Carrozzi M, et al. Gaucher's disease with Parkinson's disease: Clinical and pathological aspects. Neurology 2003;61:99-101.  Back to cited text no. 24
    
25.
Saunders-Pullman R, Hagenah J, Dhawan V, Stanley K, Pastores G, Sathe S, et al. Gaucher disease ascertained through a Parkinson's center: Imaging and clinical characterization. Mov Disord 2010;25:1364-72.  Back to cited text no. 25
    
26.
Nagral A. Gaucher disease. J Clin Exp Hepatol 2014;4:37-50.  Back to cited text no. 26
    
27.
Ankleshwaria C, Mistri M, Bavdekar A, Muranjan M, Dave U, Tamhankar P, et al. Novel mutations in the glucocerebrosidase gene of Indian patients with Gaucher disease. J Hum Genet 2014;59:223-8.  Back to cited text no. 27
    
28.
Pulkes T, Choubtum L, Chitphuk S, Thakkinstian A, Pongpakdee S, Kulkantrakorn K, et al. Glucocerebrosidase mutations in Thai patients with Parkinson's disease. Parkinsonism Relat Disord 2014;20:986-91.  Back to cited text no. 28
    
29.
Li Y, Sekine T, Funayama M, Li L, Yoshino H, Nishioka K, Tomiyama H, et al. Clinicogenetic study of GBA mutations in patients with familial Parkinson's disease. Neurobiol Aging 2014;35:935 e3-8.  Back to cited text no. 29
    
30.
Nichols WC, Pankratz N, Marek DK, Pauciulo MW, Elsaesser VE, Halter CA, et al., P.I. Parkinson Study Group. Mutations in GBA are associated with familial Parkinson disease susceptibility and age at onset. Neurology 2009;72:310-6.  Back to cited text no. 30
    
31.
Zhang L, Quadri M, Guedes LC, Coelho M, Valadas A, Mestre T, et al. Comprehensive LRRK2 and GBA screening in Portuguese patients with Parkinson's disease: Identification of a new family with the LRRK2 p. Arg1441His mutation and novel missense variants. Parkinsonism Relat Disord 2013;19:897-900.  Back to cited text no. 31
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
Print this article  Email this article
   
Online since 20th March '04
Published by Wolters Kluwer - Medknow