| Article Access Statistics | | | Viewed | 7808 | | | Printed | 196 | | | Emailed | 1 | | | PDF Downloaded | 380 | | | Comments | [Add] | | | Cited by others | 26 | | |
|
Click on image for details.
|
|
| CASE REPORT |
|
|
|
| Year : 2007 | Volume
: 55
| Issue : 4 | Page : 408-409 |
Severe phenytoin toxicity in a CYP2C9*3*3 homozygous mutant from India
Kesavan Ramasamy1, Sunil K Narayan2, Shashindran Chanolean1, Adithan Chandrasekaran1
1 Department of Pharmacology, Jawaharlal Institute of Medical Education and Research, Dhanvanthari Nagar, Pondicherry - 6, India
2 Department of Neurology, Jawaharlal Institute of Medical Education and Research, Dhanvanthari Nagar, Pondicherry - 6, India
| Date of Acceptance | 31-Jan-2007 |
Correspondence Address:
Sunil K Narayan
Department of Neurology, Jawaharlal Institute of Medical Education and Research, Pondicherry - 6
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0028-3886.33300
The authors report an Indian adult female patient with a history of generalized tonic clonic seizures who developed severe features of phenytoin (DPH) toxicity on therapeutic dosage of this antiepileptic drug. Administration of 300mg/day of DPH in this patient resulted in toxic symptoms associated with an excessive serum DPH concentration of 33μg/ml. The PCR-RFLP analysis revealed a homozygosity involving CYP2C9*3*3. This mutation results in a marked decrease in the enzymatic activity (CYP2C9) and leads to a decreased clearance of the drug which can lead to severe acute and chronic toxicity. On switching the antiepileptic therapy from DPH to sodium valproate, there was reversal of both.
Keywords: CYP2C9 polymorphism, phenytoin toxicity
How to cite this article:
Ramasamy K, Narayan SK, Chanolean S, Chandrasekaran A. Severe phenytoin toxicity in a CYP2C9*3*3 homozygous mutant from India. Neurol India 2007;55:408-9 |
Phenytoin / Diphenyl hydantoin (DPH) is a well-established, widely prescribed first line drug for the treatment of simple and complex partial seizures as well as generalized seizure. It is metabolized by cytochrome P450 enzyme CYP2C9 (90%) and CYP2C19 (10%). The rate of metabolism of DPH is genetically determined and varies by ethnicity and race. In the Tamil Nadu population, the frequency of CYP2C9 alleles viz. CYP2C9*1, CYP2C9*2, CYP2C9*3 has been established. The distribution of CYP2C9*2 and *3 mutant alleles in our population (0.04 and 0.08) was less than that of the Caucasians (0.12 and 0.08) but more than that of Orientals (0.00 and 0.03). [1]
The mutant alleles of CYP2C9*2(29%) and CYP2C9*3(95%) have lower enzymatic activity compared with wild (normal) type CYP2C9*1. [2] Owing to its zero order (nonlinear) pharmacokinetics and a narrow therapeutic window, DPH may reach high level in the individual possessing mutant alleles ( CYP2C9*2 and CYP2C9*3 ), which results in precipitation of adverse effects at the conventional dosages. Though association of CYP2C9 genetic polymorphism with adverse effects of DPH has been well documented in ethnic groups such as Caucasians and Orientals, [3],[4],[5] this is the first report addressing the influence of CYP2C9 genetic polymorphism on DPH toxicity in any Indian patient.
| » Case Report | |  |
A 22-year-old lady (weight, 38kg; height, 145cm) had been on long-term DPH therapy (12 months) for primary generalized epilepsy at a variable daily dose of 200-300-mg/day. Though she was advised sodium valproate initially, this had to be replaced by DPH since the patient could not afford the former while the latter was freely supplied in the hospital. In July 2002, she was hospitalized with adverse effects and poor compliance of DPH with resultant poor control of seizures. On neurological examination, this patient was found to have nystagmus, ataxia and excessive sedation. Physical examination also revealed lymphadenopathy, pain and deformity of multiple bones, anemia, hirsutism, acne and gum hypertrophy (Grade III). Skeletal survey revealed multiple fractures at various stages of healing along with features suggestive of osteomalacia. Hemoglobin level, plasma albumin level and body mass index (BMI) were 6.5 gm %, 3.3 g/dl and 18.1 respectively. Phenytoin (DPH) toxicity was suspected and plasma DPH was estimated in the patient by reverse phase HPLC method as described by Gerson et al . [6] The DPH level was 33.2 mg/L at prescribed dosage of 300 mg/day of DPH over the preceding one month period. The DPH was stopped and the acute toxicity symptoms subsided immediately. The DPH was substituted with sodium valproate whose compliance was monitored and ensured without any adverse effects. Over a period of six months, seizures remained well controlled. Clinically, gum hyperplasia (Grade I), acne, hirsutism and anemia had also reversed significantly.
The clinical and plasma level evidences of DPH toxicity prompted appropriate pharamacogenomics studies. Patient's DNA was extracted from peripheral blood leucocytes by conventional phenol-chloroform method and genotyping of CYP2C9 for *1, *2 and *3 alleles was performed by a polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) method. [7] The CYP2C9*2 (Arg144Cys) was detected using the forward and reverse primers 5' TACAAATACAATGAAAATATCATG 3' and 5' CTAACAACCAGA CTCATAATG 3', respectively.' The amplified PCR products were digested with 5 U restriction enzymes AvaII by overnight incubation at 37˚C.
The detection for CYP2C9*3 (Ile359Leu) was performed using two separate mismatched forward PCR primers 5'AATAATAATATGCACGAGGTCCAGAGATGC 3' and 5' AATAATAATATGCACGAGGTCCAGAGGTAC 3' and an intron 7 reverse primer 5' GATACTATGAATTTGGGACTT C3 '. The first mismatched primer introduced an NsiI site in Ile359 and the second mismatched forward primer introduced a KpnI site in Leu359 alleles. The amplified PCR products were digested with 5 U restriction enzymes NsiI and KpnI by overnight incubation at 37˚C.
The digested PCR products were separated by electrophoresis using an 8% polyacrylamide gel and stained with ethidium bromide. Samples containing CYP2C9*1 allele produced 521-bp and 169-bp after digestion with Ava II, while those containing CYP2C9*2 allele were not digested. Normal alleles produced 112-bp and 29-bp fragments after NsiI digestion and CYP2C9*3 mutant allele produced 111-bp and 30-bp fragments after KpnI digestion.
| » Discussion | | |
A 22-year-old lady with epilepsy on chronic DPH therapy had definite features of acute DPH toxicity at hospitalization which was documented by plasma DPH estimation as well. In addition, she also had clinical features such as lymphadenopathy, acne, hirsutism and gum hyperplasia (Grade III) [8],[9] which are well-known adverse effects of long-term DPH therapy. Multiple bone fractures in this young lady are unlikely to be due to convulsions and falls alone and more likely to be pathological features secondary to hypovitaminosis D, another recognized DPH adverse effect. Though the anemia was not evaluated fully, there is a possibility of megaoblastosis due to DPH-induced folate deficiency. Thus it appears that she had severe chronic DPH toxicity as well. The DPH drug level at hospitalization was estimated to be 33.2 mg/L and genotype result was found to be homozygous CYP2C9*3*3 .
After switching from DPH to sodium valproate, seizures remained well controlled and her acute toxicity symptoms disappeared. On follow-up for six months, there was a significant reduction in the chronic toxicity features as well. It was obvious that DPH was not to be the drug of choice for primary generalized epilepsy in this patient. Pharmacogenomics studies before initiating antiepileptic therapy could have easily identified the unfavorable genotype of CYP2C9, a major DPH metabolizing enzyme in this case, and prompted the physicians to choose and convince the patient on the need for an alternate antiepileptic drug such as sodium valproate. This would have avoided a number of iatrogenic complications of antiepileptic drug therapy in this case, which resulted in poor drug compliance and poor seizure control as well. The fact that the same enzyme also metabolizes drugs like warfarin, tolbutamide, losartan, diclofenac etc adds to the value of this genotyping since many elderly epileptic patients have co-morbidity and could be candidates for co-prescription with these drugs as well. We recommend that wherever possible, the clinicians may do CYP2C9 genotyping of the epileptic patients before prescribing DPH.
| » References | | |
| 1. | Adithan C, Gerard N, Vasu S, Balakrishnan R, Shashindran CH, Krishnamoorthy R. Allele and genotype frequency of CYP2C9 in Tamilnadu population. Eur J Clin Pharmacol 2003;59:707-9.  [PUBMED] [FULLTEXT] |
| 2. | Lee CR, Goldstein JA, Pieper JA. Cytochrome P450 2C9 polymorphisms: A comprehensive review of the in vitro and human data. Pharmacogenetics 2002;12:251-63. [PUBMED] [FULLTEXT] |
| 3. | Ninomiya H, Mamiya K, Matsuo S, Ieiri I, Higuchi S, Tashiro N. Genetic polymorphism of the CYP2C subfamily and excessive plasma phenytoin concentration with central nervous system intoxication. Ther Drug Monit 2000;22:230-2. [PUBMED] [FULLTEXT] |
| 4. | Citerio G, Nobili A, Airoldi L, Pastorelli R, Patruno A. Severe intoxication after phenytoin infusion: A preventable pharmacogenetic adverse reaction. Neurology 2003;60:1395-6. [PUBMED] [FULLTEXT] |
| 5. | Kidd RS, Curry TB, Gallagher S, Edeki T, Blaisdell J, Goldstein JA. Identification of a null allele of CYP2C9 in an African-American exhibiting toxicity to phenytoin. Pharmacogenetics 2001;11:803-8. |
| 6. | Gerson B, Bell F, Chan S. Antiepileptic agents- primidone, phenobarbital, phenytoin and carbamazepine by reversed-phase liquid chromatography. Clin Chem 1984;30:105-8. [PUBMED] [FULLTEXT] |
| 7. | Sullivan-Klose TH, Ghanayem BI, Bell DA, Zhang ZY, Kaminsky LS, Shenfield GM, et al . The role of the CYP2C9-Leu359 allelic variant in the tolbutamide polymorphism. Pharmacogenetics 1996;6:341-9. [PUBMED] |
| 8. | Soga Y, Nishimura F, Ohtsuka Y, Araki H, Iwamoto Y, Naruishi H, et al . CYP2C polymorphism, phenytoin metabolism and gingival overgrowth in epileptic subjects. Life Science 2004;74:827-34. |
| 9. | Angelopoulos AP, Goaz PW. Incidence of diphenylhydantoin gingival hyperplasia. Oral Surg 1972;34:898-906. [PUBMED] |
| This article has been cited by | | 1 |
CYP2C9 Variations and Their Pharmacogenetic Implications Among Diverse South Asian Populations |
|
| Sheikh Nizamuddin, Shivendra Dubey, Sakshi Singh, Saurav Sharma, Pratheusa Machha, Kumarasamy Thangaraj | | Pharmacogenomics and Personalized Medicine. 2021; Volume 14: 135 | | [Pubmed] | [DOI] | | | 2 |
An update on CYP2C9 polymorphisms and phenytoin metabolism: implications for adverse effects |
|
| Wan-Chun Chang, Shuen-Iu Hung, Bruce C Carleton, Wen-Hung Chung | | Expert Opinion on Drug Metabolism & Toxicology. 2020; 16(8): 723 | | [Pubmed] | [DOI] | | | 3 |
Pharmacogenetics of adverse reactions to antiepileptic drugs |
|
| I. Fricke-Galindo,H. Jung-Cook,A. LLerena,M. López-López | | Neurología (English Edition). 2017; | | [Pubmed] | [DOI] | | | 4 |
Individualized Phenytoin Therapy for Japanese Pediatric Patients With Epilepsy Based on CYP2C9 and CYP2C19 Genotypes |
|
| Yoshiaki Yamamoto,Yukitoshi Takahashi,Katsumi Imai,Kou Miyakawa,Hiroko Ikeda,Yuki Ueda,Tokito Yamaguchi,Hirosato Nasu,Hideyuki Ohtani,Hideo Shigematsu,Yoshiyuki Kagawa,Yushi Inoue | | Therapeutic Drug Monitoring. 2015; 37(2): 229 | | [Pubmed] | [DOI] | | | 5 |
Farmacogenética de reacciones adversas a fármacos antiepilépticos |
|
| I. Fricke-Galindo,H. Jung-Cook,A. LLerena,M. López-López | | Neurología. 2015; | | [Pubmed] | [DOI] | | | 6 |
CYP2C9 polymorphisms and phenytoin metabolism: implications for adverse effects |
|
| Valentina Franco,Emilio Perucca | | Expert Opinion on Drug Metabolism & Toxicology. 2015; 11(8): 1269 | | [Pubmed] | [DOI] | | | 7 |
Implications of pharmacogenetics for the therapeutic use of antiepileptic drugs |
|
| Chiara Piana,Natalicia de Jesus Antunes,Oscar Della Pasqua | | Expert Opinion on Drug Metabolism & Toxicology. 2014; : 1 | | [Pubmed] | [DOI] | | | 8 |
Influence of CYP2C9 polymorphism and phenytoin co-administration on acenocoumarol dose in patients with cerebral venous thrombosis |
|
| Tanima De,Rita Christopher,Dindagur Nagaraja | | Thrombosis Research. 2014; 133(5): 729 | | [Pubmed] | [DOI] | | | 9 |
Farmacogenetica dei farmaci antiepilettici |
|
| M.W. Mann,S. Chhun,G. Pons | | EMC - Neurologia. 2014; 14(4): 1 | | [Pubmed] | [DOI] | | | 10 |
Clinical Pharmacogenetics Implementation Consortium Guidelines for CYP2C9 and HLA-B Genotypes and Phenytoin Dosing |
|
| K E Caudle,A E Rettie,M Whirl-Carrillo,L H Smith,S Mintzer,M T M Lee,T E Klein,J T Callaghan | | Clinical Pharmacology & Therapeutics. 2014; | | [Pubmed] | [DOI] | | | 11 |
Neurological toxicity after phenytoin infusion in a pediatric patient with epilepsy: influence of CYP2C9, CYP2C19 and ABCB1 genetic polymorphisms |
|
| P Dorado,E López-Torres,E M Peñas-LLedó,J Martínez-Antón,A LLerena | | The Pharmacogenomics Journal. 2013; 13(4): 359 | | [Pubmed] | [DOI] | | | 12 |
Role of CYP2C9 polymorphism in phenytoin-related metabolic abnormalities and subclinical atherosclerosis in young adult epileptic patients |
|
| Kanitpong Phabphal,Alan Geater,Kitti Limapichart,Pornchai Sathirapanya,Suwanna Setthawatcharawanich | | Seizure. 2013; 22(2): 103 | | [Pubmed] | [DOI] | | | 13 |
The association between CYP 2C9 polymorphism and bone health |
|
| Kanitpong Phabphal,Alan Geater,Kitti Limapichat,Pornchai Sathirapanya,Suwanna Setthawatcharawanich,Rattana Leelawattana | | Seizure. 2013; 22(9): 766 | | [Pubmed] | [DOI] | | | 14 |
Pharmacogenetics and antiepileptic drug metabolism: Implication of genetic variants in cytochromes P450 [Farmacogenética y metabolismo de fármacos antiepilépticos: Implicación de variantes genéticas en citocromos P1450] |
|
| Saldaña-Cruz, A.M. and Sánchez-Corona, J. and Márquez de Santiago, D.A. and GarcÃa-Zapién, A.G. and Flores-MartÃnez, S.E. | | Revista de Neurologia. 2013; 56(9): 471-479 | | [Pubmed] | | | 15 |
Role of CYP2C9 polymorphism in phenytoin-related metabolic abnormalities and subclinical atherosclerosis in young adult epileptic patients |
|
| Phabphal, K. and Geater, A. and Limapichart, K. and Sathirapanya, P. and Setthawatcharawanich, S. | | Seizure. 2013; 22(2): 103-108 | | [Pubmed] | | | 16 |
From evidence based medicine to mechanism based medicine. Reviewing the role of pharmacogenetics |
|
| Bob Wilffert,Jesse Swen,Hans Mulder,Daan Touw,Anke-Hilse Maitland-Van der Zee,Vera Deneer | | International Journal of Clinical Pharmacy. 2013; 35(3): 369 | | [Pubmed] | [DOI] | | | 17 |
Genotype–phenotype correlation of cytochrome P450 2C9 polymorphism in Indian National Capital Region |
|
| Ekta Varshney,Nilanjan Saha,Monika Tandon,Vikesh Shrivastava,Shakir Ali | | European Journal of Drug Metabolism and Pharmacokinetics. 2013; | | [Pubmed] | [DOI] | | | 18 |
Association of CYP2C9 polymorphisms with phenytoin toxicity in Indian patients |
|
| Thakkar, A.N. and Bendkhale, S.R. and Taur, S.R. and Gogtay, N.J. and Thatte, U.M. | | Neurology India. 2012; 60(6): 577-580 | | [Pubmed] | | | 19 |
Genetic basis of phase II drug-metabolizing enzymes in antiepileptic drug toxicity |
|
| Grover, S. and Kukreti, R. | | Pharmacogenomics. 2012; 13(5): 521-522 | | [Pubmed] | | | 20 |
Research Highlights |
|
| Sandeep Grover, Ritushree Kukreti | | Pharmacogenomics. 2012; 13(5): 519 | | [VIEW] | [DOI] | | | 21 |
Pharmacogenomics and epilepsy: the road ahead |
|
| Gianpiero L Cavalleri, Mark McCormack, Saud Alhusaini, Elijah Chaila, Norman Delanty | | Pharmacogenomics. 2011; 12(10): 1429 | | [VIEW] | [DOI] | | | 22 |
From evidence based medicine to mechanism based medicine. Reviewing the role of pharmacogenetics |
|
| Bob Wilffert, Jesse Swen, Hans Mulder, Daan Touw, Anke-Hilse Maitland-Van der Zee, Vera Deneer | | International Journal of Clinical Pharmacy. 2011; 33(1): 3 | | [VIEW] | [DOI] | | | 23 |
Influence of CYP2C9 and CYP2C19 genetic polymorphisms on phenytoin-induced neurological toxicity in Indian epileptic patients |
|
| Ramasamy Kesavan, Sunil K. Narayan, Chandrasekaran Adithan | | European Journal of Clinical Pharmacology. 2010; 66(7): 689 | | [VIEW] | [DOI] | | | 24 |
Update on the genetic polymorphisms of drug-metabolizing enzymes in antiepileptic drug therapy |
|
| Saruwatari, J. and Ishitsu, T. and Nakagawa, K. | | Pharmaceuticals. 2010; 3(8): 2709-2732 | | [Pubmed] | | | 25 |
Update on the Genetic Polymorphisms of Drug-Metabolizing Enzymes in Antiepileptic Drug Therapy |
|
| Junji Saruwatari,Takateru Ishitsu,Kazuko Nakagawa | | Pharmaceuticals. 2010; 3(8): 2709 | | [Pubmed] | [DOI] | | | 26 |
The tough fate of prototype drugs. Activation problems of the angiotensin receptor blocker, losartan [Der schwere stand der leitsubstanzen aktivierungsprobleme des angiotensin-rezeptor-antagonisten losartan] |
|
| Petersen, K.-U. | | Nieren- und Hochdruckkrankheiten. 2009; 38(11): S21-S32 | | [Pubmed] | |
|
|
|
|
|
|
|
|
