| Article Access Statistics | | | Viewed | 6418 | | | Printed | 233 | | | Emailed | 2 | | | PDF Downloaded | 153 | | | Comments | [Add] | | | Cited by others | 11 | | |
|
Click on image for details.
|
|
| BRIEF REPORT |
|
|
|
| Year : 2010 | Volume
: 58
| Issue : 4 | Page : 627-630 |
R778L, H1069Q, and I1102T mutation study in neurologic Wilson disease
Jayantee Kalita1, Bindu I Somarajan1, Usha K Misra1, Balraj Mittal2
1 Department of Neurology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, India
2 Department of Genetics, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, India
| Date of Acceptance | 11-Jun-2010 |
| Date of Web Publication | 24-Aug-2010 |
Correspondence Address:
Jayantee Kalita
Department of Neurology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Raebareily Road, Lucknow - 226 014
India
 Source of Support: Sanjay Gandhi Post Graduate Institute of Medical Sciences through Intramural Research Funding, Conflict of Interest: None  | Check |
DOI: 10.4103/0028-3886.68678
There is paucity of the studies on mutations in neurologic Wilson disease (WD) in India. We studied H1069Q, R778L, I1102T mutations in 26 patients with neurologic WD from 25 families in north India. The basis of diagnosis of neurologic WD was clinical, Kayser-Fleischer (KF) ring, and ceruloplasmin. Data collected included: family history, clinical characteristics, laboratory data, ultrasound findings, magnetic resonance imaging (MRI) findings, and severity of the disease. DNA was isolated from venous blood and subjected to H1069Q, R778L, and I1102T mutation study. The age range was 5-41 years. Family history was present in 8 patients. The H1069Q, R778L, and I1102T mutations were absent in all the patients and in 16 parents and siblings. Severity of the illness was related to the extent of MRI changes but not with age of onset and hepatic involvement. H1069Q, R778L, and I1102T mutations were absent in our patients, which may be due to genetic and ethnic heterogeneity and further studies are required.
Keywords: ATP7B, genetic, magnetic resonance imaging, mutation, polymerase chain reaction, Wilson disease
How to cite this article:
Kalita J, Somarajan BI, Misra UK, Mittal B. R778L, H1069Q, and I1102T mutation study in neurologic Wilson disease. Neurol India 2010;58:627-30 |
| » Introduction | |  |
Wilson disease (WD) is an autosomal recessive disorder of copper metabolism resulting in pathologic accumulation of copper in various organs and tissues. This disease is caused by mutations in ATP7B gene spanning more than 80 kb genomic DNA on chromosome 13q14.2-q21. The ATP7B gene has 21 exons and the protein encoded has 1465 amino acids. ATP7B gene product helps in transporting copper into the secretory pathway for incorporation into apoceruloplasmin and excretion into the bile. Mutations in ATP7B gene result in impaired trafficking of copper in and through the hepatocytes. Currently, over 320 mutations and 80 polymorphisms have been identified ( http://www.medgen.med.ualberta.ca/database ). The pattern and frequency of these mutations vary in different geographic regions and ethnic groups. H1069Q mutation has been reported as the commonest form in Europe [1] and R778L in China. [2] In a study in 20 families with WD from Greece, 20 different mutations were found: H1069Q in 35%, R969Q in 12%, 2530 del A in 7%, L936X in 7%, and I1148T in 3%. The genotype-phenotype correlation revealed a milder disease with H1069Q and R969Q mutations. [3] In Brazilian patients, mutations have been reported in exon 8 and 15, the commonest being 340 2 del c in 30.5% patients. Different phenotypic expressions of the same genetic defect have been demonstrated, suggesting the role of a modifying factor. [4] WD with neuropsychiatric manifestations in patients from Columbia demonstrated mutations in T1232P. [5] In Chinese patients, mutations have been reported in exon 8, 12, and 13, and there was no genotypic-phenotypic correlation. [6] We have earlier reported the pattern of multimodality-evoked potential changes in patients with neurologic WD. [7] In India, genetic studies on WD have been reported from Chandigarh, Kolkata, and Vellore, however, the findings were not the same. [8],[9],[10] There is paucity of studies correlating ATP7B mutation with clinicoradiologic changes in patients with neurologic WD in India. In this study, we report the results of commonly reported mutations, R778L, H1069Q, and I1102T, in patients with neurologic WD from north India.
| » Materials and Methods | | |
Consecutive patients with neurologic WD have been evaluated. The study was approved by the Institute Ethics Committee. The diagnosis was based on clinical symptoms and signs of neurologic involvement, low serum ceruloplasmin (<20 mg/dL), and presence of Kayser-Fleischer ring More Details on slit lamp examination. Patients were subjected to a detailed clinical evaluation, including demographics, pedigree charting, and education level. The presence of osteoarticular deformities, bone pain, jaundice, renal impairment, anemia, and hepatosplenomegaly were noted. Cognitive functions were evaluated by mini-mental state examination (MMSE). Cognitive impairment was considered when MMSE score was below 29 for 9 years of schooling, below 26 for 5-8 years of schooling, and below 22 for 0-4 years of schooling. [11] Various movement disorders were recorded and videotaped. The severity of neurologic WD was based on activity of daily living (ADL) and the sum score of 5 signs (dysarthria, tremor, ataxia, rigidity/bradykinesia, and chorea/dystonia). These 5 signs were rated on a 0-3 scale; 0 being absent and 3 being severe. The severity of the disease was graded as: grade I (mild), grade II (moderate, sum score 2-7 and independent for ADL), and grade III (severe, sum score >7 and dependent for ADL). [12] Cranial magnetic resonance imaging (MRI) was performed using 1.5T, GE Signa Medical System, USA, and T1, T2, and PD spin echo sequences were obtained from the axial and sagittal sections. The abnormal signal changes and their locations were recorded. The patients were treated with penicillamine or zinc, or both. Various clinical, radiologic, and genetic findings were correlated using Chi square and Fisher's exact tests.
Genetic study
For genetic study, 5 mL of venous blood was collected in ethylenediaminetetraacetic acid and stored at −70°C and DNA was isolated by Miller's salting out method. [13]
Polymerase chain reaction
For polymerase chain reaction (PCR), 200 ng of genomic DNA was amplified using primers described elsewhere. [14],[15],[16] PCR was carried out by using 1 U of Taq DNA polymerase enzyme, 25 pmole of forward and reverse primer, and 200 μM dNTPs in 25 μL reaction volume. Each PCR cycle consisted of initial denaturation at 95°C for 5 min, denaturation at 94°C for 20 s, annealing at 58°C for 30 s, and extension at 72°C for 25 s for 35 cycles, and final extension at 72°C for 7 min. After amplification, PCR products were checked on 2% agarose gel.
Restriction fragment length polymorphism
Restriction fragment length polymorphism (RFLP) was carried out for the most common mutations described in WD, H1069Q and R778L. For R778L, exon 8 of ATP7B gene was amplified and the PCR product (296 bp) was digested by using 10 U of restriction enzyme MspI. All the patients showed 256 bp + 40 bp DNA fragment on polyacrylamide gel after ethidium bromide staining; indicating wild type. [14] For H1069Q, exon 14, a second PCR was performed using the first PCR product (337 bp) as template, and in the semi-nested PCR we used the intronic forward primer (P1) and mismatched reverse primer (TGCGGAGGCCAGCAGTGAGC) to obtain 130-bp PCR products. [15] On restriction digestion analysis with restriction digestion enzyme BsiHKA1, all the patients showed wild type giving 110 bp + 20 bp. Analysis of another mutation reported from India, I1102T, was also carried out. The analysis was done by amplifying exon 15 and the PCR product (255 bp) was digested using 10 U of restriction enzyme EcoR1. On restriction digestion analysis, the PCR products were completely undigested giving 255 bp showing wild pattern. [16]
| » Results | | |
Twenty-six WD patients from 25 families were studied. Their median was age 14.5 years (range 5-41 years, five below 12 years of age). The majority of the patients were Hindu (20) and 16 were Muslim. Out of 20 Hindu WD, 8 were Brahmins, 3 Kshatriyas, 5 Vaishyas and 4 others. Twenty-three patients were from Uttar Pradesh, two from Bihar and one from Madhya Pradesh. Disease onset was in first decade in nine patients, second decade in 16 patients, and fourth decade in one patient. Family history of WD was present in eight patients. History of jaundice was present in 15, drooling of saliva in 18, movement disorder in 21, walking difficulty in 17, cognitive impairment in 15, and seizure in seven patients. Dystonia affecting oromandibular region, trunk, and limbs was present in 21 patients. Other movement disorders included: tremor in eight, chorea in two, myoclonus in two, tremor and chorea in two, chorea and myoclonus in four, and chorea and athetosis in two patients. The disease severity was: mild in eight, moderate in 12, and severe in six patients. Of the 18 patients who had cranial MRI, 16 patients had abnormal findings: putamen in 14, caudate in 12, globus pallidus in 10, thalamus in eight, subcortical white matter in seven, brainstem in ten, and cortex in six patients. The median number of regions involved on MRI was 4 (range 0-8). The clinical disease severity and MRI changes are summarized in [Table 1].  | Table 1 : Relationship of clinical severity of neurologic Wilson disease with age of onset, hepatic involvement, and extent of MRI change
Click here to view |
RFLP of R778L, H1069Q, and I1102T did not reveal any abnormality in our patients [Figure 1]a-c. RFLP of R778L, H1069Q, I1102T was also done for 16 parents and siblings, but did not reveal any abnormality. | Figure 1 : a : Restriction fragment length polymorphism analysis of I1102T mutation study in exon 15 of with Wilson disease showing wild-type pattern of uncut 255 base pairs, M = 50-base pair ladder.
b : Restriction fragment length polymorphism analysis of R778L mutation study in exon 8 showing wild pattern in Wilson disease patients (1, 2, 3, 4, 5, 6, 7, 8, and 9). U = undigested polymerase chain reaction product, m = 100-base pair ladder
c : Restriction fragment length polymorphism analysis of H1069Q mutation study of a patient with Wilson disease showing restricted product (110+20 base pairs), M = 50-base pair ladder
d : Cranial magnetic resonance imaging of the same patient showing T2 hyperintensity in bilateral thalami, globus pallidus, putamen, and caudate and right frontal subcortical white matter who had severe neurologic Wilson disease
Click here to view |
The severity of illness was not related to the age of onset of clinical disease (P = 0.43) and associated hepatic involvement (P = 0.32) but correlated with the extent of MRI changes (P = 0.0001). All the patients with more than two region involvement on MRI had moderate to severe illness, whereas all patients with two or less region involvement had mild disease [Figure 1]d. Fifteen patients received penicillamine and zinc, nine received penicillamine, and two received zinc. At six months follow-up, 18 improved by at least two grades in disability scale, three remained static, and five deteriorated (three in penicillamine and zinc group and one in penicillamine, and one in zinc group).
| » Discussion | | |
In the present study, RFLP of R778L, I1102T, and H1069Q did not reveal any abnormality. The R778L has been reported to have a high allele frequency in oriental population, such as the Japanese, Chinese, and Korean. The allele frequency of R778L was 37.9% in Korean, 27% in Japanese, and 24-44% in Chinese WD patients. Liu et al. reported R778L in 74% WD patients with hepatic manifestations. [14] R778W and I1102T mutations were present in 36% of WD patients from north India. [16]
In Eastern Europe, up to 38% of WD patients carry H1069Q mutation in the homozygous state, which is less frequent in the Mediterranean and almost absent in the Asian WD patients. [17] Although a dominant type of ATP7B mutation has been reported from most of the countries, the ATP7B mutation from 3 different centers in India was quite variable and none found a dominant mutation. Fifty-one ATP7B mutations have been reported in 130 WD patients from three Indian centers: Chandigarh (North India), Kolkata (East India), and South India. [8],[9],[10] C318A mutation was found to be a common mutation from Kolkata and South India. Eleven novel mutations from South India, 18 from Chandigarh (North India), and five from Kolkata (East India) have been reported. None of these studies revealed single predominant ATP7B mutations. The commonest mutations from North India were T33053, C2975A, 2977insA, and 3031insC, 6% each, from East India C813A in 19%, and from South India G3182A in 16%, and C813A in 12% WD patients. The hot spots of mutations from South India were exon 18 and 13, from East India exon 2, and from North India exon 8, 12, 13, 15, 16, and 18. [8],[9],[10] We have analyzed commonly reported mutations from India and other countries but they were absent in our patients. The absence of these three mutations studied in our patients may be due to the study design, patient population (as all our patients had neurologic WD), or genetic heterogeneity. The reported Indian studies mostly evaluated hepatic WD, [8],[9],[10] whereas we have evaluated neurologic WD and 50% of our patients did not have a history of jaundice. Interestingly, most of our patients belonged to upper caste: Hindus (16) and Muslims (6), whereas only four were from lower caste Hindus, although the latter constitutes more than 70% of the Uttar Pradesh population. The higher incidence in Muslims may be due to consanguinity as three of our patients were borne out of consanguineous marriage. The higher frequency of WD in upper caste Hindus may be due to better health awareness or genetic susceptibility, which needs further evaluation. Evaluation of other reported mutations in our patients is required and if found negative, further candidate gene sequencing is needed. Lack of correlation of clinical severity and type of ATP7B mutations have been reported earlier [6] ; however, R969Q mutations have been reported with mild [3] and H1069Q with severe neurologic manifestations, [15] and Arg778Leu in homozygous conditions with early onset of WD with hepatic manifestations. [18] From this study, it can be concluded that WD patients from North India, mostly Uttar Pradesh, did not reveal R778L, I1102T, and H1069Q mutations. The negative results in our study may be due to genetic and ethnic diversity and further studies are required.
| » Acknowledgment | | |
This study was supported by Sanjay Gandhi Post Graduate Institute of Medical Sciences through Intramural Research Funding. We thank Mr. Rakesh Kumar Nigam for secretarial help.
| » References | | |
| 1. | Abonyi M, Folhoffer A, Lakatos PL. Wilson disease. Orv Hetil 2004;145:2147-51.  [PUBMED] |
| 2. | Liu XQ, Zhang YF, Liu TT, Gu XF, Hsiao KJ, Bao KR, et al. Genotype and phenotype correlation in Chinese patients with Wilson's Disease. Zhonghua Er Ke Za Zhi 2003;41:35-8. [PUBMED] |
| 3. | Panagiotakaki E, Tzetis M, Manolaki N, Loudianos G, Papatheodorou A, Manesis E, et al. Genotype-phenotype correlations for a wide spectrum of mutations in the Wilson disease gene (ATP7B). Am J Med Genet 2004;131:168-73. [PUBMED] [FULLTEXT] |
| 4. | Deguti MM, Genschel J, Cancado EL, Barbosa ER, Bochow B, Mucenic M, et al. Wilson disease: Novel mutations in the ATP7B gene and clinical correlation in Brazilian patients. Hum Mutat 2004;23:398. [PUBMED] [FULLTEXT] |
| 5. | Velez-Pardo C, Rio MJ, Moreno S, Ramirez-Gomez L, Correa G, Lopera F. New mutation (T1232P) of the ATP-7B gene associated with neurologic and neuropsychiatric dominance onset of Wilson's disease in three unrelated Colombian kindred. Neurosci Lett 2004;367:360-4. |
| 6. | Gu YH, Kodama H, Du SL, Gu QJ, Sun HJ, Ushijima H. Mutation spectrum and polymorphisms in ATP 7B identified on direct sequencing of exons in Chinese Han and Hui ethnic patients with Wilson's disease. Clin Genet 2003;64:479-84. [PUBMED] [FULLTEXT] |
| 7. | Das M, Misra UK, Kalita J. A study of clinical, MRI and multimodality evoked potentials in neurologic Wilson disease. Eur J Neurol 2007;14:498-504. [PUBMED] [FULLTEXT] |
| 8. | Gupta A, Aikath D, Neogi R, Dutta S, Basu K, Maity B. Molecular pathogenesis of Wilson disease: Haplotype analysis detection of prevalent mutation and genotype phenotype correlation in Indian patients. Hum Genet 2005;118:49-57. |
| 9. | Kumar S, Thapa BR, Kaur G, Prasad R. Identification and molecular characterisation of 18 novel mutations in the ATP7B gene from Indian Wilson disease patients: Genotype. Clin Genet 2005;67:443-5. [PUBMED] [FULLTEXT] |
| 10. | Santhosh S, Shaji RV, Eapen CE, Jayanthi V, Malathi S, Chandy M, et al. ATP 7B mutations in families in a predominantly southern Indian cohort of Wilson disease patients. Indian J Gastroenterol 2006;25:277-82. [PUBMED] |
| 11. | Grun RM, Anthony JC, Basset SS, Fulstein MF. Population based norms for the mini-mental state examination by age and education level. JAMA 1993;269:2386-91. |
| 12. | Grimm G, Prayer L, Oder W, Ferenci P, Madl C, Knoflach P, et al. Comparison of functional and structural brain disturbances in Wilson's disease. Neurology 1991;41:272-6. [PUBMED] |
| 13. | Miller S, Dykes D, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;116:1215. |
| 14. | Liu XQ, Zhang YF, Liu TT, Gu XF, Hsiao KJ. Correlation of ATP7B genotype with phenotype in Chinese patients with Wilson disease. World J Gastroenterol 2004:10:590-3. |
| 15. | Gabor F, Ferenci P, Lakatos PL, Szalay F, Polli C, Glant TT. Common Mutations of ATP7B in Wilson disease patients from Hungary. Am J Med Genet 2002;108:23-8. |
| 16. | Kumar S, Thapa BR, Kaur G, Prasad R. Analysis of most common mutations R778G, R778L, I1102T and H1069Q in Indian Wilson disease patients: Correlation between genotype/phenotype/copper ATPase activity. Mol Cell Biochem 2007;294:1-10. [PUBMED] [FULLTEXT] |
| 17. | Shimizu N, Nakazono H. Molecular analysis and diagnosis in Japanese patients with Wilson's disease. Pediatr Int 1999;41:409-13. |
| 18. | Wu ZY, Wang N, Lin TM, Fang L, Murong SX, Yu L. Mutation analysis and the correlation between genotype and phenotype of Arg 778Leu mutation in Chinese patients with Wilson disease. Arch Neurol 2001;58:971-6. |
[Figure 1]
[Table 1]
| This article has been cited by | | 1 |
A systematic review and meta-analysis of the R778L mutation in ATP7B with Wilson's disease in China |
|
| Ziru Xue, Hongyu Chen, Lan Yu, Peifang Jiang | | Pediatric Neurology. 2023; | | [Pubmed] | [DOI] | | | 2 |
Genomic Variations in ATP7B Gene in Indian Patients with Wilson Disease |
|
| Aabha Nagral, Snehal Mallakmir, Nikita Garg, Kritika Tiwari, Suzena Masih, Nishtha Nagral, Ojas Unavane, Ajay Jhaveri, Shubha Phadke, GaneshPrasad ArunKumar, Rakesh Aggarwal | | Indian Journal of Pediatrics. 2022; | | [Pubmed] | [DOI] | | | 3 |
Mutational analysis of exon 8 and exon 14 of ATP7B gene in Bangladeshi children with Wilson disease |
|
| Ruhina Tasmeen, A. S. M. Bazlul Karim, Laila Anjuman Banu, Enayet Hossain, Md. Rokunuzzaman, Wahiduzzaman Majumder, Syeda Tabassum Alam, Rafia Rasid, Md. Benzamin, Md. Sharif Hasan | | Indian Journal of Gastroenterology. 2022; | | [Pubmed] | [DOI] | | | 4 |
Novel mutations of ATP7B gene in Wilsonæs disease patients of South Indian cohort |
|
| Advithi Rangaraju,Kavitha Anbarasu,M.S. Sridhar,Sharat Reddy Putta,Sachin Daga | | Meta Gene. 2017; 14: 114 | | [Pubmed] | [DOI] | | | 5 |
A study of dose response and organ susceptibility of copper toxicity in a rat model |
|
| Vijay Kumar,Jayantee Kalita,U.K. Misra,H.K. Bora | | Journal of Trace Elements in Medicine and Biology. 2015; 29: 269 | | [Pubmed] | [DOI] | | | 6 |
A study of MRI changes in Wilson disease and its correlation with clinical features and outcome |
|
| A. Ranjan,J. Kalita,S. Kumar,S.K. Bhoi,U.K. Misra | | Clinical Neurology and Neurosurgery. 2015; 138: 31 | | [Pubmed] | [DOI] | | | 7 |
Spectrum of mutations in the ATP binding domain of ATP7B gene of Wilson Disease in a regional Indian cohort |
|
| Sreenivasa Rao Guggilla,Jalandhar Reddy Senagari,P.N. Rao,Sujatha Madireddi | | Gene. 2015; 569(1): 83 | | [Pubmed] | [DOI] | | | 8 |
Role of Oxidative Stress in the Worsening of Neurologic Wilson Disease Following Chelating Therapy |
|
| Jayantee Kalita,Vijay Kumar,Abhay Ranjan,Usha K. Misra | | NeuroMolecular Medicine. 2015; 17(4): 364 | | [Pubmed] | [DOI] | | | 9 |
A study of oxidative stress, cytokines and glutamate in Wilson disease and their asymptomatic siblings |
|
| Jayantee Kalita,Vijay Kumar,Usha K. Misra,Abhay Ranjan,Hamidullah Khan,Rituraj Konwar | | Journal of Neuroimmunology. 2014; 274(1-2): 141 | | [Pubmed] | [DOI] | | | 10 |
Genetics of Wilsonæs disease: A clinical perspective |
|
| Kumar, S.S. and Kurian, G. and Eapen, C.E. and Roberts, E.A. | | Indian Journal of Gastroenterology. 2012; 31(6): 285-293 | | [Pubmed] | | | 11 |
Genetics of Wilson’s disease: a clinical perspective |
|
| S. Suresh Kumar,George Kurian,C. E. Eapen,Eve A. Roberts | | Indian Journal of Gastroenterology. 2012; 31(6): 285 | | [Pubmed] | [DOI] | |
|
|
|
|
|
|
|
|
