Atormac
brintellex
Neurology India
menu-bar5 Open access journal indexed with Index Medicus
  Users online: 2493  
 Home | Login 
About Editorial board Articlesmenu-bullet NSI Publicationsmenu-bullet Search Instructions Online Submission Subscribe Videos Etcetera Contact
  Navigate Here 
 Search
 
  
 Resource Links
  »  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
  »  Article in PDF (628 KB)
  »  Citation Manager
  »  Access Statistics
  »  Reader Comments
  »  Email Alert *
  »  Add to My List *
* Registration required (free)  

 
  In this Article
 »  Abstract
 » Introduction
 »  Materials and Me...
 » Results
 » Discussion
 »  References
 »  Article Figures
 »  Article Tables

 Article Access Statistics
    Viewed2226    
    Printed57    
    Emailed0    
    PDF Downloaded72    
    Comments [Add]    
    Cited by others 3    

Recommend this journal

 


 
Table of Contents    
ORIGINAL ARTICLE
Year : 2014  |  Volume : 62  |  Issue : 4  |  Page : 387-392

Association of -1382A>G CCL11 gene variant with ischemic stroke, its subtypes and hemorrhagic stroke in a South Indian population


1 Department of Molecular Biology, Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Begumpet; Dr. NTR University of Health Sciences, Vijaywada, Andhra Pradesh, India
2 Department of Molecular Biology, Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Begumpet; Centre for Human Genetics, School of Health Sciences, Central University of Punjab, Bathinda, Punjab, India
3 Nizams Institute of Medical Sciences, Punjagutta, Hyderabad, India
4 Department of Molecular Biology, Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Begumpet, India

Date of Submission24-Feb-2014
Date of Decision06-Apr-2014
Date of Acceptance24-Aug-2014
Date of Web Publication19-Sep-2014

Correspondence Address:
Anjana Munshi
Centre for Human Genetics, School of Health Sciences, Central university of Punjab, Bathinda, Punjab
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0028-3886.141259

Rights and Permissions

 » Abstract 

Background: CCL11 (Eotaxin-1) is an important inflammatory cytokine belonging to the CC family of chemokines associated with a number of infection or inflammation-related diseases such as atherosclerosis and stroke. We investigated the association of CCL11 gene polymorphism rs4795895-1382A>G with ischemic and hemorrhagic stroke. Materials and Methods: Six hundred and twenty ischemic stroke patients, 620 age- and sex-matched healthy controls, and 220 hemorrhagic stroke patients, 220 age- and sex-matched healthy controls were included in the present study. The CCL11 gene polymorphism rs4795895-1382A>G was determined using PCR-RFLP technique. Results: We found a statistically significant difference in the genotypic distribution between ischemic stroke patients and controls (For GG vs. AA, χ2 = 7.604; P < 0.001, Odds ratio = 2.793; 95% CI = 1.308-5.9). For GG vs. AA + AG, χ2 = 44.8, P < 0.001, Odds ratio = 2.382 (95% CI = 1.842-3.081). A significant difference was observed in the frequency of G and A alleles in patients and controls (For G vs. A, χ2 = 43.26; P < 0.001, Odds ratio = 2.127; 95% CI = 1.693-2.672). Statistically significant difference was observed in the genotypic distribution between hemorrhagic stroke patients and controls (For GG vs. AG, χ2 = 26.78; P = 0.001, Odds ratio = 3.5; 95% CI = 2.162-5.824). A significant difference was observed in the frequency of G and A alleles in patients and controls (For G vs. A, χ2 = 41.98; P = 0.001, Odds ratio = 4.1; 95% CI = 2.61-6.44). Conclusion: The results of the present study show that the GG genotype is a significant risk factor for ischemic as well as hemorrhagic stroke. Further, the frequency of the GG genotype was observed to be higher in hemorrhagic stroke patients in comparison with ischemic stroke. Evaluating the association with ischemic stroke subtypes, a significant association was observed with intracranial large artery atherosclerosis and lacunar stroke.


Keywords: CCL11 gene, eotaxin-1, hemorrhagic stroke, ischemic stroke, rs4795895-1382A>G polymorphism


How to cite this article:
Roy S, Das S, Munshi A, Kaul S, Jyothy A. Association of -1382A>G CCL11 gene variant with ischemic stroke, its subtypes and hemorrhagic stroke in a South Indian population. Neurol India 2014;62:387-92

How to cite this URL:
Roy S, Das S, Munshi A, Kaul S, Jyothy A. Association of -1382A>G CCL11 gene variant with ischemic stroke, its subtypes and hemorrhagic stroke in a South Indian population. Neurol India [serial online] 2014 [cited 2020 Oct 24];62:387-92. Available from: https://www.neurologyindia.com/text.asp?2014/62/4/387/141259



 » Introduction Top


Stroke is one of the most common causes of mortality and adult disability worldwide. [1] Commonly, stroke is a multi-factorial disorder that is influenced by both genetic and environmental factors. [2],[3],[4],[5],[6],[7],[8],[9],[10],[11] In India, stroke is a major health problem and ischemic stroke is the most common type of stroke. [12],[13] Although the exact etiology and mechanisms of stroke have not been well understood, studies have confirmed that high blood pressure, poor diet, smoking, obesity, and lack of physical activities are common risk factors associated with 80% of all strokes. [14] However, these conventional risk factors do not completely account for the overall risk of stroke. In addition, genetic factors have been suggested to play a major role in the stroke risk. Several studies show that inflammatory processes play a major significant role in pathophysiology and etiology of stroke. [15] Atherosclerotic stroke is a result of chronic inflammation involving pathways of immune regulation, thrombosis, and cellular adhesion. [16],[17] Inflammatory mechanisms are also involved in the progression of intracerebral hemorrhage (ICH). After ICH, prominent inflammatory responses occur, which are characterized by the production of inflammatory mediators such as the cytokines. [18] Inflammatory molecules and gene variants coding for inflammatory mediators significantly contribute to the development and progress of cerebrovascular and cardiovascular diseases. [19] The present study investigates the association of CCL11gene polymorphism rs4795895-1382A>G with ischemic stroke, its sub-types and hemorrhagic stroke.

Eotaxin-1 also known as C-C motif chemokine 11 [CCL11] and eosinophil chemotactic protein is an inflammatory cytokine that is involved in the allergic response by selectively engaging eosinophils by inducing their chemotaxis. [20],[21],[22] Inflammatory chemokine CCL11 is involved in the formation and rupture of cerebral aneurysms. It plays a very significant role as chemoattractants for leukocytes directing them towards sites of tissue inflammation. [23] The human CCL11 gene is located on chromosome number 17q21.1-q21, spans approximately 8 kb and consists of 3 exons. CCL11 operates mainly through CCR3 a G-protein-coupled receptor with seven transmembrane spanning domains. [24],[25],[26],[27] CCR3 receptor is present on several cells including eosinophils, basophils, mast cells, dendritic cells, brain microglial cells, and endothelial cells. [25],[27],[28],[29],[30] Several CC chemokines have been identified in injured arteries and in the atherosclerotic plaque. [31] It has been observed that CCL11 antigen is found in smooth muscle cells of human atheroma [32] and its level is upregulated in the media of ischemic rat aorta. [33] Recent studies indicate that CCL11 induces chemotaxis of human microvascular endothelial cells [34] and plays a role in number of chronic inflammatory diseases. [35] Elevated plasma levels of CCL11 gene have been observed in patients with advanced atherosclerosis. [36] A single nucleotide change of adenine to guanine at 1382 position located in the 5′ flanking region of CCL11 gene was reported to be significantly associated with stroke in Chinese Hans population. [37] Until date, there are no reports on the association of this polymorphism with stroke in Indian patients. Therefore, the present study was carried out to investigate the association of CCL11 gene polymorphism rs4795895-1382 A>G with ischemic stroke, its subtypes, and hemorrhagic stroke in a South Indian population from Andhra Pradesh.


 » Materials and Methods Top


Six hundred and twenty ischemic stroke patients (males:females = 431:189) and 220 hemorrhagic stroke patients (males:females = 158:62) presenting with new stroke evaluated in the neurology department of Nizam's Institute of Medical Sciences, Hyderabad (A.P, India) between August 2007 and July 2013 were included in the study. The study was approved by the ethical committee of the study hospital and of the institution. All patients were examined by a qualified stroke neurologist. Ischemic and hemorrhagic strokes were differentiated by computed tomography (CT) scans and magnetic resonance imaging (MRI). All patients underwent CT scan as well as MRI. Patients with major cardiac, hepatic, renal, endocrinological disorders, skeletal disorders, and cancerous diseases were excluded from this study. The ischemic stroke was classified into subtypes according to the TOAST classification. [38] As control group, 620 healthy individuals (males:females = 428:192) and 220 healthy individuals (males:females = 430:180) matched for sex and age for comparison with ischemic patients and hemorrhagic patients respectively were recruited from the same demographic area. The controls had no clinical evidence of any cerebrovascular disease. Information on demographic features and risk factors was collected by using a structured questionnaire. Hypertension, alcohol use, diabetes, and smoking were defined as reported previously (39). Subjects included in the study were above the age group of 18 years. All samples were collected only after obtaining the written informed consent.

DNA isolation and genotyping

Five milliliters of blood was collected in EDTA-coated tubes and genomic DNA was extracted from blood samples using standard phenol-chloroform method. The rs4795895-1382A>G polymorphism in CCL11 gene was analyzed by using PCR and RFLP technique. The primers used for the amplification of the CCL11 bearing the polymorphism-1382A>G are forward: 5′ TCCTGCTCTTACCCTAGCAGA 3′ and reverse 5′ TGCCCATCTAGGATAATTGGTC 3′. The amplified 231-base pair (bp) PCR product was digested with MvaI restriction enzyme (Fermentas Fast digest) by incubating at 37°C for 5 min followed by separation of fragments on 2% agarose gel. Most common homozygous (GG) genotype shows the presence of a fragment of 231 bp, heterozygous (AG) shows 106 bp and 125 bp bands, and rare homozygous genotype (AA) was detected as 106-, 125-, and 231-bp bands.

Statistical analysis

Hardy-Weinberg equilibrium was tested for the CCL11 gene rs4795895-1382A>G polymorphism. Association between genotypes with ischemic and hemorrhagic stroke was examined by odds ratio with 95% confidence interval (CI) and Chi-square analysis using Open EPI6 software (Open Epi Version 2.3.1 from Department of Epidemiology, Rollins School of Public Health, Emory University, Atlanta, GA 30322, USA). Allelic frequencies were calculated according to the number of different alleles observed and the total number of alleles examined. Statistical significance was defined as P < 0.05.


 » Results Top


Six hundred and twenty ischemic stroke patients, 620 age- and sex-matched controls, 220 hemorrhagic stroke patients, and 220 healthy controls from the same demographic area were included in the study. All patients belonged to a South Indian population from Andhra Pradesh. The clinical characteristics of the ischemic stroke patients and controls are given in [Table 1]. Mean age was 49.4 years for ischemic patients and 49.08 years in controls. Risk factor profile of the ischemic patients revealed hypertension in 57.8%, diabetes in 44.7%, smoking in 43.81%, alcohol use in 33.1%, and family history of stroke in 26.8% subjects. In the control group, 32.1% had hypertension, 28.8% were diabetic, 31.9% smokers, 25.8% were alcohol users, and 11.7% had a family history of stroke. The plasma levels of LDL and TG were significantly elevated (P < 0.001) whereas HDL levels were significantly reduced in ischemic stroke patients when compared to controls (P < 0.001). The demographic and clinical data of the hemorrhagic stroke patients and controls have been summarized in [Table 2]. The mean age of hemorrhagic stroke patients was 53.8 years and that for controls was 54.7 years. Profiles of patients for the various risk factors revealed hypertension in 55.85%, diabetes in 33.04%, smoking in 38%, alcohol use in 42%, and family history of stroke in 5% of patients. In the control group, 41% had hypertension, 28.02% were diabetic, 30% smokers, 29% were alcoholic, and only 2% had family history of stroke. Hemorrhagic stroke patients also had significantly higher serum triglycerides (P < 0.001).
Table 1: Clinical characteristics of ischemic stroke patients and controls

Click here to view
Table 2: Clinical characteristics of hemorrhagic stroke patients and controls

Click here to view


The genotypic distribution of CCL11 rs4795895-1382A>G polymorphism and frequency of A and G alleles in ischemic stroke patients and controls has been given in [Table 3]. There was a statistically significant difference in the genotypic distribution between patients and controls. The frequency of GG genotype and G allele was significantly high in ischemic stroke patients in comparison with the controls. (For GG vs. AA, χ2 = 7.604; P < 0.001, Odds ratio = 2.793; 95% CI = 1.308-5.9). For GG vs. AA + AG, χ2 = 44.8; P < 0.001, Odds ratio = 2.382; 95% CI = 1.842-3.081). A significant difference was observed in the frequency of G and A alleles in patients and controls (For G vs. A, χ2 = 43.26; P < 0.001, Odds ratio = 2.127; 95% CI = 1.693-2.672). We performed multiple logistic regression analysis with a forward stepwise selection controlling all other confounding factors and GG genotypes of the CCL11 gene. It was observed that the GG genotype is a significant risk factor for ischemic stroke. Examining the association of Eotaxin-1 gene polymorphism rs4795895-1382A>G with ischemic stroke subtypes classified according to TOAST classification, we found significant association with intracranial large artery atherosclerosis (P < 0.001, odds ratio = 9.298; 95% CI = 5.432-16.32) and small artery occlusion (P < 0.001, odds ratio = 9.798; 95% CI = 4.876-19.62) [Table 4]. Intracranial large artery atherosclerosis is the most common subtype in the study population as reported previously. [39] The genotypic distribution of CCL11 rs4795895-1382A>G polymorphism and frequency of G and A alleles in hemorrhagic patients and controls has been given in [Table 5]. A significant difference was observed in the genotypic distribution between patients and controls. The frequency of the GG genotype was significantly higher in patients in comparison with controls. For GG vs. AG, χ2 = 26.7; P < 0.001, Odds ratio = 3.54; 95% CI = 2.126-5.824). A significant difference was observed in the frequency of G and A alleles in patients and controls (For G vs. A, χ2 = 41.98; P < 0.001, Odds ratio = 4.1; 95% CI; 2.61-6.44). The distribution of -1382A>G genotypes, in ischemic stroke patients, hemorrhagic stroke patients and controls has been depicted graphically in [Figure 1] and [Figure 2]. Further, we compared the ischemic stroke patients with the hemorrhagic stroke group for genotypic distribution. The frequency of GG genotype was significantly high in hemorrhagic stroke group in comparison with Ischemic stroke group (For GG vs. AG, χ2 = 4.088; P = 0.001, Odds ratio = 1.59; 95% CI = 1.012-2.499) [Table 6].
Figure 1: Distribution of CCL-11 (-1382A>G) genotypes among ischemic stroke patients and controls

Click here to view
Figure 2: Distribution of CCL-11 (-1382A>G) genotypes among hemorrhagic stroke patients and controls

Click here to view
Table 3: Distribution of CCL11 genotypes and allelic frequencies in ischemic stroke patients and controls

Click here to view
Table 4: Eotaxin-1 genotypic and allelic frequencies in ischemic stroke patients classified according to TOAST classification

Click here to view
Table 5: Distribution of CCL11 genotypes and allelic frequencies in hemorrhagic stroke patients and controls

Click here to view
Table 6: Distribution and comparison of Eotaxin-1 genotypes and allele frequencies in ischemic stroke and hemorrhagic
stroke group


Click here to view



 » Discussion Top


In this study, we assessed the relationship of rs4795895 SNPs in CCL11 gene involved in inflammatory response, with the risk of ischemic stroke and hemorrhagic stroke in a South India population from Andhra Pradesh. An association of CCL11 gene rs4795895-1382A>G polymorphism (GG genotype, G allele) was observed with the risk of ischemic as well as hemorrhagic stroke. A case-control study carried out by Zhao et al. (2012) including 1224 ischemic stroke patients and 1163 controls from a Chinese Han population showed that CCL11 rs4795895 gene polymorphism was significantly associated with ischemic stroke. [37] However, we did not find AA bearing individuals in the hemorrhagic group. This is in agreement with a previous study carried out in Chinese population, where A allele was the rare allele. [37] Several previous studies have reported the significant role of CCL11 gene in inflammation and in the pathogenesis of coronary artery disease in various ethnic groups. [23],[40],[41] There are various mechanisms through which the Eotaxin gene relates to the risk of stroke. It could be because it plays a prominent role in the development of atherosclerosis as studies indicate that the expression of the Eotaxin gene is higher in human atherosclerosis. [32] Eotaxin also plays a vital role in the progression of atherosclerosis as it is prominently expressed in endothelium and vascular smooth muscle cells in human atheroma. [42],[43] Circulating eotaxin levels have been found to be increased in patients with coronary artery disease and elevated levels of eotaxin could be involved in the development of inflammatory responses in heart and brain. [44] To the best of our knowledge, this study is the first to demonstrate the association of CCL11 genetic polymorphisms -1382A>G with the risk of ischemic and hemorrhagic stroke in a South Indian population from Andhra Pradesh. However, the exact functional significance of this (rs4795895) polymorphism to ischemic and hemorrhagic stroke remains to be further elucidated and CCL11 gene polymorphism could signify promising therapeutic targets in the prevention of stroke. In conclusion, the present study shows that -1382A>G polymorphism of CCL11 gene is associated with risk of ischemic and hemorrhagic stroke in the South Indian population from Andhra Pradesh. Evaluating the association with ischemic stroke subtypes a significant association was observed with intracranial large artery atherosclerosis and lacunar stroke.

 
 » References Top

1.Bonita R, Mendis S, Truelsen T, Bogousslavsky J, Toole J, Yatsu F. The global stroke initiative. Lancet Neurol 2004;3:391-3.  Back to cited text no. 1
    
2.Dichgans M. Genetics of ischaemic stroke. Lancet Neurol 2007;6:149-61.  Back to cited text no. 2
    
3.Munshi A, Babu MS, Kaul S, Shafi G, Anila AN, Alladi S, et al. Phosphodiesterase 4D (PDE4D) gene variants and the risk of ischemic stroke in a South Indian population. J Neurol Sci 2009;285:142-5.  Back to cited text no. 3
    
4.Munshi A, Sharma V, Kaul S, Al-Hazzani A, Alshatwi AA, Manohar VR, et al. Estrogen receptor α genetic variants and the risk of stroke in a South Indian population from Andhra Pradesh. Clin Chim Acta 2010;411:1817-21.  Back to cited text no. 4
    
5.Munshi A, Rajeshwar K, Kaul S, Al-Hazzani A, Alshatwi AA, Babu AU, et al. Interleukin-10-1082 promoter polymorphism and ischemic stroke risk in a South Indian population. Cytokine 2010;52:221-4.  Back to cited text no. 5
    
6.Munshi A, Rajeshwar K, Kaul S, Chandana E, Shafi G, Anila AN, et al. VNTR polymorphism in intron 4 of the eNOS gene and the risk of ischemic stroke in a South Indian population. Brain Res Bull 2010;82:247-50.  Back to cited text no. 6
    
7.Munshi A, Rajeshwar K, Kaul S, Al-Hazzani A, Alshatwi AA, Shafi G, et al. Association of tumor necrosis factor-α and matrix metalloproteinase-3 gene variants with stroke. Eur J Neurol 2011;18:1053-9.  Back to cited text no. 7
    
8.Munshi A, Sharma V, Kaul S, Al-Hazzani A, Alshatwi AA, Shafi G, et al. Association of 1347 G/A cytochrome P4504F2 (CYP4F2) gene variant with hypertension and stroke. Mol Biol Rep 2012;39:1677-82.  Back to cited text no. 8
    
9.Munshi A, Roy S, Thangaraj K, Kaul S, Babu MS, Jyothy A. Association of SNP41, SNP56 and a novel SNP in PDE4D gene with stroke and its subtypes. Gene 2012;506:31-5.  Back to cited text no. 9
    
10.Roy S, Das S, Danaboina R, Sharma V, Kaul S, Jyothy A, et al. Association of E-selectin gene polymorphism (S128R) with ischemic stroke and stroke subtypes. Inflammation 2013;37:599-603.  Back to cited text no. 10
    
11.Poungavarin N. Strokes in developing countries. Lancet 1998;352:SIII19-22.  Back to cited text no. 11
    
12.Nadamuni S. Researchers identify stroke subtypes in India. Lancet 2002;359:500.  Back to cited text no. 12
    
13.O′Donnell MJ, Xavier D, Liu L, Zhang H, Chin SL, Rao-Melacini P, et al. INTERSTROKE investigators. Risk factors for ischaemic and intracerebral haemorrhagic stroke in 22 countries (the INTERSTROKE study): A case-control study. Lancet 2010;376:112-23.  Back to cited text no. 13
    
14.Kaul S, Munshi A. Genetics of ischemic stroke: Indian perspective. Neurol India 2012;60:498-503.  Back to cited text no. 14
[PUBMED]  Medknow Journal  
15.Muir KW, Tyrrell P, Sattar N, Warburton E. Inflammation and ischaemic stroke. Curr Opin Neurol 2007;20:334-42.  Back to cited text no. 15
    
16.Goldstein LB, Adams R, Becker K, Furberg CD, Gorelick PB, Hademenos G, et al. Primary prevention of ischemic stroke: A statement for healthcare professionals from the Stroke Council of the American Heart Association. Stroke 2001;32:280-99.  Back to cited text no. 16
    
17.Ross R. Atherosclerosis - An inflammatory disease. N Engl J Med 1999;340:115-26.  Back to cited text no. 17
    
18.Wang J, Doré S. Inflammation after intracerebral hemorrhage. J Cereb Blood Flow Metab 2007;27:894-908.  Back to cited text no. 18
    
19.Flex A, Gaetani E, Papaleo P, Straface G, Proia AS, Pecorini G, et al. Proinflammatory genetic profiles in subjects with history of ischemic stroke. Stroke 2004;35:2270-5.  Back to cited text no. 19
    
20.Jose PJ, Griffiths-Johnson DA, Collins PD, Walsh DT, Moqbel R, Totty NF, et al. Eotaxin: A potent eosinophil chemoattractant cytokine detected in a guinea pig model of allergic airways inflammation. J Exp Med 1994;179:881-7.  Back to cited text no. 20
    
21.Ponath PD, Qin S, Ringler DJ, Clark-Lewis I, Wang J, Kassam N, et al. Cloning of the human eosinophil chemoattractant, eotaxin. Expression, receptor binding, and functional properties suggest a mechanism for the selective recruitment of eosinophils. J Clin Invest 1996;97:604-12.  Back to cited text no. 21
    
22.Garcia-Zepeda EA, Rothenberg ME, Ownbey RT, Celestin J, Leder P, Luster AD. Human eotaxin is a specific chemoattractant for eosinophil cells and provides a new mechanism to explain tissue eosinophilia. Nat Med 1996;2:449-56.  Back to cited text no. 22
    
23.Chalouhi N, Points L, Pierce GL, Ballas Z, Jabbour P, Hasan D. Localized increase of chemokines in the lumen of human cerebralaneurysms. Stroke 2013;44:2594-7.  Back to cited text no. 23
    
24.Sallusto F, Mackay CR, Lanzavecchia A. Selective expression of the eotaxin receptor CCR3 by human T helper 2 cells. Science 1997;277:2005-7.  Back to cited text no. 24
    
25.Uguccioni M, Mackay CR, Ochensberger B, Loetscher P, Rhis S, LaRosa GJ, et al. High expression of the chemokine receptor CCR3 in human blood basophils. Role in activation by eotaxin, MCP-4, and other chemokines. J Clin Invest 1997;100:1137-43.  Back to cited text no. 25
    
26.Forssmann U, Uguccioni M, Loetscher P, Dahinden CA, Langen H, Thelen M, et al. Eotaxin-2, a novel CC chemokine that is selective for the chemokine receptor CCR3, and acts like eotaxin on human eosinophil and basophil leukocytes. J Exp Med 1997;185:2171-6.  Back to cited text no. 26
    
27.Heath H, Qin S, Rao P, Wu L, LaRosa G, Kassam N, et al. Chemokine receptor usage by human eosinophils. The importance of CCR3 demonstrated using an antagonistic monoclonal antibody. J Clin Invest 1997;99:178-84.  Back to cited text no. 27
    
28.Romagnani P, De Paulis A, Beltrame C, Annunziato F, Dente V, Maggi E, et al. Tryptase-chymase double-positive human mast cells express the eotaxin receptor CCR3 and are attracted by CCR3-binding chemokines. Am J Pathol 1999;155:1195-204.  Back to cited text no. 28
    
29.Beaulieu S, Robbiani DF, Du X, Rodrigues E, Ignatius R, Wei Y, et al. Expression of a functional eotaxin (CC Chemokine Ligand 11) receptor CCR3 by human dendritic cells. J Immunol 2002;169:2925-36.  Back to cited text no. 29
    
30.Shieh JT, Albright AV, Sharron M, Gartner S, Strizki J, Doms RW, et al. Chemokine receptor utilization by human immunodeficiency virus type 1 isolates that replicate in microglia. J Virol 1998;72:4243-9.  Back to cited text no. 30
    
31.Mach F. The role of chemokines in atherosclerosis. Curr Atheroscler Rep 2001;3:243-51.  Back to cited text no. 31
    
32.Haley KJ, Lilly CM, Yang JH, Feng Y, Kennedy SP, Turi TG, et al. Overexpression of eotaxin and the CCR3 receptor in human atherosclerosis: Using genomic technology to identify a potential novel pathway of vascular inflammation. Circulation 2000;102:2185-9.  Back to cited text no. 32
    
33.Chen J, Akyurek LM, Fellstrom B, Hayry P, Paul LC. Eotaxin and capping protein in experimental vasculopathy. Am J Pathol 1998;153:81-90.  Back to cited text no. 33
    
34.Salcedo R, Young HA, Ponce ML, Ward JM, Kleinman HK, Murphy WJ, et al. Eotaxin (CCL11) induces in vivo angiogenic responses by human CCR3endothelial cells. J Immunol 2001;166:7571-8.  Back to cited text no. 34
    
35.Emanuele E, Falcone C, D′Angelo A, Minoretti P, Buzzi MP, Bertona M, et al. Association of plasma eotaxin levels with the presence and extent of angiographic coronary artery disease. Atherosclerosis 2006;186:140-5.  Back to cited text no. 35
    
36.Economou E, Tousoulis D, Katinioti A, Stefanadis C, Trikas A, Pitsavos C, et al. Chemokines in patients with ischaemic heart disease and the effect of coronary angioplasty. Int J Cardiol 2001;80:55-60.  Back to cited text no. 36
    
37.Zhao N, Liu X, Wang Y, Liu X, Li J, Yu L, et al. Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population. J Neuroinflammation 2012;9:162.  Back to cited text no. 37
    
38.Adams HP Jr, Bendixen BH, Kappelle LJ, Biller J, Love BB, Gordon DL, et al. Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in acute stroke treatment. Stroke 1993;24:35-41.  Back to cited text no. 38
    
39.Munshi A, Sultana S, Kaul S, Reddy BP, Alladi S, Jyothy A. Angiotensin converting enzyme insertion/deletion polymorphism and the risk of ischemic stroke in a South Indian population. J Neurol Sci 2008;272:132-5.  Back to cited text no. 39
    
40.Mo FM, Proia AD, Johnson WH, Cyr D, Lashkari K. Interferon gamma-inducible protein-10 (IP-10) and eotaxin as biomarkers in age-related macular degeneration. Invest Ophthalmol Vis Sci 2010;51:4226-36.  Back to cited text no. 40
    
41.Yang CJ, Lin CY, Hsieh TC, Olson SC, Wu JM. Control of eotaxin-1 expression and release by resveratrol and its metabolites in culture human pulmonary artery endothelial cells. Am J Cardiovasc Dis 2011;1:16-30.  Back to cited text no. 41
    
42.Cheng SS, Lukacs NW, Kunkel SL. Eotaxin/CCL11 suppresses IL-8/CXCL8 secretion from human dermal microvascular endothelial cells. J Immunol 2002;168:2887-94.  Back to cited text no. 42
    
43.Kodali RB, Kim WJ, Galaria II, Miller C, Schecter AD, Lira SA, et al. CCL11 (Eotaxin) induces CCR3-dependent smooth muscle cell migration. Arterioscler Thromb Vasc Biol 2004;24:1211-6.  Back to cited text no. 43
    
44.Farahi N, Cowburn AS, Upton PD, Deighton J, Sobolewski A, Gherardi E, et al. Eotaxin-1/CC chemokine ligand 11: A novel eosinophil survival factor secreted by human pulmonary artery endothelial cells. J Immunol 2007;179:1264-73.  Back to cited text no. 44
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6]

This article has been cited by
1 Chemokines play complex roles in cerebral ischemia
Chen Chen,Shi-Feng Chu,Dan-Dan Liu,Zhao Zhang,Ling-Lei Kong,Xin Zhou,Nai-Hong Chen
Neurochemistry International. 2018; 112: 146
[Pubmed] | [DOI]
2 Role of TLR4 (C1196T) and CD14 (C-260T) Polymorphisms in Development of Ischemic Stroke, Its Subtypes and Hemorrhagic Stroke
Satrupa Das,Subhash Kaul,Akka Jyothy,Anjana Munshi
Journal of Molecular Neuroscience. 2017; 63(3-4): 300
[Pubmed] | [DOI]
3 The Changes of Pro-inflammatory Cytokines in Serum according to the Reperfusion Time after Ischemia of Left Common Iliac Artery in Mice
Kyung shin Park,Sung Jae Kim,Younkyoung Seo
Korean Journal of Physical Anthropology. 2016; 29(1): 19
[Pubmed] | [DOI]



 

Top
Print this article  Email this article
   
Online since 20th March '04
Published by Wolters Kluwer - Medknow