 |
|
||||
| Home | Login | |||||
| About | Editorial board | Articles
|
NSI Publications
|
Search | Instructions | Online Submission | Subscribe | Videos | Etcetera | Contact |
|
||||||||||||||||||||
|
|
|
Genetic Polymorphisms in DRD4 and Risk for Parkinson's Disease Among Eastern Indians
Correspondence Address: Source of Support: None, Conflict of Interest: None DOI: 10.4103/0028-3886.344670
Keywords: Dopamine transporter D4, genetic association, India, Parkinson's disease, polymorphisms
Parkinson's disease (PD) is a late-onset multifactorial progressive neurodegenerative disorder resulting from selective loss of dopaminergic neurons in the substantia nigra. Along with the mutations in causal genes, common genetic variants in modifier genes involved in dopamine metabolism also confer PD susceptibility.[1] Dopamine receptor 4 (DRD4) encodes a transmembrane protein (G-protein coupled receptor) of the D2 subtype, which is widely expressed in the central nervous system, particularly in the retina, prefrontal cortex, hippocampus, amygdala, and hypothalamus. It regulates the motor behavior and activity of nigrostriatal neurons. Association studies on polymorphic variants located in promoter and exon 3 of DRD4 with several neurological diseases and psychiatric disorders across different populations show ethnicity-dependent contradictory findings.[2],[3] Given this background, considering the multiethnic population of India and differences between those, herein we determined the role of DRD4 polymorphic variants (i.e., 120 base pair duplication marker, rs1800955C/T, and 48 base pair variable number of tandem repeats (VNTR)) among eastern Indian PD patients following a study that had been reported among North and South Indian populations.[2]
Recruitment of study subjects Patients were diagnosed at the Movement Disorders Clinic, Bangur Institute of Neurosciences, Kolkata, India. The inclusion criteria for PD were as follows: to have bradykinesia and at least two of the three cardinal features (i.e., resting tremor, rigidity, and postural instability). Any individual having secondary Parkinsonism More Details and drug-induced Parkinsonism were excluded from the study. A total of 291 PD patients [mean age of onset: 49.6 ± 12.3 years; 75.6% male; early age at onset ≤45 years = 98, positive family history = 57] and 265 ethnically matched unrelated healthy controls [mean age: 58.3 ± 7.55 years, 76.6% male] with no personal or family history of Parkinsonism and/or any neurological symptoms were recruited in the present study. All subjects provided written informed consent as per the guidelines of the Indian Council of Medical Research (ICMR). The internal review committee on research using human samples cleared the project after proper review. Genetic analysis and statistical analysis Genomic DNA isolated from peripheral blood[4] was subjected to polymerase chain reaction (PCR) to the genotype of 120 base pair tandem duplication variant (amplicon length: 428 bp/548 bp) in 5'UTR and 48 base pair repeat sequence (R) [amplicon length: 379 (2R)/427 (3R)/475 (4R)/523 (5R)/571 (6R)/619 (7R)] in exon 3 by using primer pairs, respectively; DRD4_120F: 5'-GTTGTCTGTCTTTTCTCATTGTT-3'; DRD4_120R: 5'-GAAGGAGCAGGCACCGTGAGC-3' and VNTR_F: 5'-GCGACTACGTGGTCTACTCGTC-3': and VNTR_R: 5'AGGACCCTCATGGCCTTG-3'. For genotyping rs1800955C/T, PCR-Restriction Fragment Length Polymorphism (RFLP) was performed using FspI (New England Biolabs, UK) (fragment size: 249 bp + 228 bp for T allele and 477 bp for C allele) as per the manufacturer's protocol. The initial amplicon was generated using a set of primer of sequence: rs1800955_F: CCTACCTAGCTCACGGTCTTGG, rs1800955_R: GAGAAACCGACAAGGATGGAG. Haplotype analysis The linkage disequilibrium (LD) between the polymorphic variants and the frequency of the different haplotypes constructed using those were determined using Haploview (version 4.2). Statistical analysis Hardy–Weinberg equilibrium (HWE) at each site was tested using a Chi-square test with one degree of freedom. For the association study, the data were evaluated for P value, odds ratio, and 95% confidence interval (CI) by using Javastat (http://statpages.info/ctab2x2.html).
The conflicting evidence of association of DRD4 in different ethnic populations (not yet tested in eastern Indian PD patients) encouraged us to genotype two functional promoter variants (120 bp duplication marker and rs1800955C/T) and one coding variant (48 bp VNTR) of DRD4 for their potential association with PD in ethnically matched 291 unrelated PD patients and 265 healthy controls among Eastern Indians. The study subjects recruited here do not harbor mutations in alpha-synuclein, PRKN, PINK, DJ-1, LRRK2, and GBA. All three variants in DRD4 were in HWE among controls and showed complete absence of linkage disequilibrium (r2 = 0 for both patients and controls; data not shown). [Table 1] shows the allele and genotypic frequency of each variant studied. For 120 bp duplication marker-a promoter variant, duplicated allele (dup) [P = 0.036; OR = 1.323; 95% CI: 1.014–1.725] and its homozygous genotype (dup/dup) [P = 0.034; OR = 1.452; 95% CI: 1.025–2.057] were found to be associated with risk for PD [Table 1]A. Further stratification of subjects revealed 120 bp dup/dup genotype as additional risk factor for sporadic PD among eastern Indians [P = 0.039; OR = 1.465; 95% CI: 1.029–2.086]. However, we did not observe any association of this variant with age at onset, gender, and positive family history (data not shown). On the contrary, for rs1800955C/T, neither allele nor genotype was found to be associated with the disease [Table 1]B.
Furthermore, it was observed that the most studied allelic variant (allele 4, 475 bp) of 48 bp repeat sequence was the predominant entity for both cases and controls with no major difference in the frequencies of the allele. Similarly, no disease-associated longer allele for this variant [Table 1]C and haplotype was obtained among Eastern Indians [Table 2].
Identification of genetic risk variants in PD pathogenesis has long been reported in different populations.[2],[4] In the present study, we have identified 120 bp duplication marker as risk factor for PD in eastern Indians in both allelic and genotypic manner with Odds ratio of 1.323 & 1.452 respectively. This promoter can regulate DRD4 gene expression, and its duplicated allele variant has been shown to have reduced transcriptional activity compared to the wild type as evident from in-vitro studies.[5] This reduced expression can be correlated with reduced dopamine uptake by postsynaptic neurons, leading to the pathogenesis of PD. However, our result is not consistent with a Caucasian report and another Indian report.[2],[6] There was absence of association among Caucasians while it acts as a protective factor among North and South Indians.[2] Several factors such as ethnicity, differences in sample inclusion criteria, experimental strategy, and sample size may have contributed to the observed association in our population and reported discrepancy. Population heterogeneity of the Indian population can be explained by the mitochondrial DNA profile, which suggests that both the North Indian population and Eastern Indians are Caucasoid in origin,[7] while the South Indian population is representative of the original Dravidian from Central and South India. Although North and Eastern Indians belong to the same Indo-European (IE) lineage, the lack of consistency in the nature of association may be due to genetic divergence between two groups of the same ethnolinguistic cluster as mentioned by a study on the genetic landscape of the Indian population. The higher degree of genetic heterogeneity among IE speakers is usually a result of different extents of admixtures with indigenous populations over different time periods since their entry into India.[8] A recent study from eastern India suggests no association of mitochondrial DNA variations with PD.[9] For another promoter polymorphism, rs1800955C/T, our data is consistent with North Indians and Japanese, unlike South Indians.[2],[10] A study in 2006, employing a series of 5' promoter deletion mutants and transient transfection into neuroblastoma (SK-N-F1 and IMR32) and retinoblastoma (Y79) cell lines for luciferase reporter assay, failed to find a direct effect of rs1800955C/T polymorphism on transcriptional activity.[11] Among all, the most studied DRD4 marker is 48 bp VNTR, which is located in exon 3. It was assumed to regulate gene expression in a post-transcriptional manner. Schoots and Van Tol determined reduced DRD4 expression with the 7-repeat sequence compared to the 2- and 4-repeat sequences when they were introduced downstream of a luciferase vector.[12] Moreover, the potency of dopamine was found to inhibit cyclic AMP formation about twofold reduced for the 7-repeat allele in comparison to the 4-repeat (wild type) and 2-repeat alleles of this variant.[13] Our finding is consistent with Japanese, Chinese, Caucasians, and another report from India.[2],[6],[10],[14] Unlike Juyal et al.,[2] we failed to find the combined effect of these markers as a haplotype toward disease susceptibility. It is quite possible that a haplotype often appears to be nonfunctional as different functional polymorphisms in it negate the effect of each other. A pioneer work on DRD4 in mice model revealed that mutant mice manifest hypokinesia due to unbalanced dopamine signaling in mid-brain regions.[15] On the contrary, no statistically significant relationship between mRNA expression levels and genotypes for these three polymorphisms was observed by Simpson et al.[16] in post-mortem brain tissues. Only a weak trend toward the 7-repeat of the exon 3 VNTR decreasing DRD4 mRNA expression was noticed. Despite such findings, our study is underpowered even for the promoter variant that showed a positive association. Therefore, our data would have been more strengthened by support from further in-vivo analysis. However, the unavailability of autopsy brain samples was a major limitation for such in-vivo studies. Similarly, although we evaluated previously studied genetic variants of DRD4 as a susceptibility factor, sequencing of the entire gene in a pilot cohort prior to marker selection could have been more justified for providing population-specific unique information.
In conclusion, our study demonstrates that DRD4 plays a small role in PD pathogenesis among Eastern Indians. The duplication variant of 120bp tandem duplication marker in DRD4 promoter was evaluated as a genetic risk factor. Ethnicity-dependent association of DRD4 with PD among Indians may be explained by the difference in genetic makeup between subpopulations. Further, replication study in larger cohorts from different populations and meta-analysis is required to corroborate the role of DRD4 in PD pathogenesis. Acknowledgements The authors are thankful to the patients for participating in the study. Financial Support and Sponsorship The study has been supported by a grant from the Department of Science and Technology, Cognitive Science Research Initiative (DST-CSI) Program, Government of India (SR/CSI/89/2010) to JR. The second author (AB) was supported by a postdoctoral fellowship from the same Research Initiative Program (SR/CSRI/PDF-32/2014 and DST/CSRI-P/2017/22) and the first author (DS) was supported by a pre-doctoral fellowship from the University Grants Commission, New Delhi. Conflicts of Interest There are no conflicts of interest.
[Table 1], [Table 2]
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||
