Neurol India Home 
 

ORIGINAL ARTICLE
Year : 2013  |  Volume : 61  |  Issue : 4  |  Page : 383--388

In vitro differentiation of cultured human CD34+ cells into astrocytes

Katari Venkatesh1, Lokanathan Srikanth1, Bhuma Vengamma2, Chodimella Chandrasekhar3, Akula Sanjeevkumar4, Bodapati Chandra Mouleshwara Prasad4, Potukuchi Venkata Gurunadha Krishna Sarma1,  
1 Department of Biotechnology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India
2 Department of Neurology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India
3 Department of Hematology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India
4 Department of Neurosurgery, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India

Correspondence Address:
Potukuchi Venkata Gurunadha Krishna Sarma
Department of Biotechnology, Sri Venkateswara Institute of Medical Sciences, Tirupati - 517 507, Andhra Pradesh
India

Abstract

Background: Astrocytes are abundantly present as glial cells in the brain and play an important role in the regenerative processes. The possible role of stem cell derived astrocytes in the spinal cord injuries is possible related to their influence at the synaptic junctions. Aim: The present study is focused on in vitro differentiation of cultured human CD34+ cells into astrocytes. Materials and Methods: Granulocyte-colony stimulating factor mobilized human CD34+ cells were isolated from peripheral blood using apheresis method from a donor. These cells were further purified by fluorescence-activated cell sorting and cultured in Dulbecco«SQ»s modified eagle«SQ»s medium. Thus, cultured cells were induced with astrocyte defined medium (ADM) and in the differentiated astrocytes serine/threonine protein kinases (STPK) and glutamine synthetase (GLUL) activities were estimated. The expression of glial fibrillary acidic protein (GFAP) and GLUL were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR). Results: The cultured human CD34+ cells differentiated into astrocytes after 11 h of incubation in ADM. The RT-PCR experiment showed the expression of GLUL (1.5 kb) and GFAP (2.9 kb) in differentiated astrocytes. The high enzyme activities of GLUL and STPK in differentiated astrocytes compared with cultured human CD34+ cells confirmed astrocyte formation. Conclusion: In the present study, in vitro differentiation of stem cells with retinoic acid induction may result in the formation of astrocytes.



How to cite this article:
Venkatesh K, Srikanth L, Vengamma B, Chandrasekhar C, Sanjeevkumar A, Mouleshwara Prasad BC, Sarma PV. In vitro differentiation of cultured human CD34+ cells into astrocytes.Neurol India 2013;61:383-388


How to cite this URL:
Venkatesh K, Srikanth L, Vengamma B, Chandrasekhar C, Sanjeevkumar A, Mouleshwara Prasad BC, Sarma PV. In vitro differentiation of cultured human CD34+ cells into astrocytes. Neurol India [serial online] 2013 [cited 2021 May 15 ];61:383-388
Available from: https://www.neurologyindia.com/text.asp?2013/61/4/383/117615


Full Text

 Introduction



Human multipotent stem cells have the ability to differentiate into all cell types of body. [1],[2],[3] Nervous tissue primarily originates from ectoderm and neurogenesis is modulated by a broad range of stimuli involving specific inducing substances and cytokines. [4] Retinoic acid (RA) is involved in the formation of astrocytes, oligodendrocytes and microglia. In addition, RA is also involved in the maintenance of adult neurons and neural stem cells. [5],[6],[7] The biological effects of RA is mediated by retinoid receptors (retinoic acid receptors [RAR] and retinoid X receptors [RXR]) where, RA forms dimers with RAR-RXR stimulating the expression of astrocyte specific genes glial fibrillary acidic protein (GFAP), glutamine synthetase (GLUL) etc. [8]

Astrocytes are the major glial cells in the central nervous system (CNS) and play an important role in nourishing neurons, regulation of extracellular ion, transmitter homeostasis and maintenance of the blood-brain barrier. [9] In addition, they act as guiding structures for neuronal migration during the development, contributing neurotransmitter metabolism and participate in the repair and regeneration processes. Furthermore, it has been shown that astrocytes, which are in close contact with active synaptic terminals participate in the formation of tripartite junctions. [10] Astrocyte-neuron cross talk through the release of several neurotrophic factors play a role in the maintenance of CNS homeostasis.[11] All Type III intermediate filament proteins like GFAP are involved in the cytoskeleton structure and provide mechanical support to astrocytes [12] and GFAP has been used as a marker in determining the stellate morphology of astrocytes, which is maintained by the phosphorylation carried out by specific serine/threonine kinases. [13],[14],[15] Thus, differentiated astrocytes generated from autologous stem cells probably may be used in the treatment of some of the neurodegenerative diseases and spinal cord injuries. The present study is aimed in the development of astrocytes from human CD34+ stem cells.

 Materials and Methods



Isolation of CD34+ cells from human peripheral blood

Peripheral blood stem cells were mobilized with granulocyte-colony stimulating factor (5 μg/kg/day) for up to three consecutive days in a donor and stem cells were separated by using Rvy kit fitted to an automated blood cell separator system AS.TEC 204 (Fresenius-Kabi, Germany). The protocol was approved by Institutional Ethics Committee, SVIMS University. [1] Enumeration and purification of human CD34+ cells were carried out by using fluorescence-activated cell sorting (FACS) (Becton-Dickinson FACS Calibur™, USA) by staining with CD34-R-phycoerythrin conjugated mouse anti-human monoclonal antibody (clone-581), Atto-488 labeled mouse anti-human CD45 antibody (clone-H130), (ReaPan S34, Bangalore) and 7-amino-actinomycin D was used to exclude dead CD34+ cells to assist in counting live CD34+ cells and purify CD34+ cells. The harvested pure CD34+ cells were used in the culturing experiments. Cell morphology was assessed with Leishman's stain under light microscope. Cell viability was measured as ≥85% by Trypan blue exclusion assay and which was considered as acceptable criteria for in vitro proliferation and differentiation studies. [1]

In vitro culture and characterization of CD34+ cells

The isolated CD34+ cells were washed and re-suspended in 1 mL of Dulbecco's modified eagle's medium (DMEM) and expanded in DMEM containing 10% fetal bovine serum at 37°C with 5% CO 2 and 95% humidity. Presence of CD34+ stem cells growing in the culture was evaluated by immuno cytochemical staining using anti-human CD34 monoclonal antibody (QBEND 10 clone, Dako). [1] Thus, obtained monolayer culture of human CD34+ cells were used for the differentiation into astrocytes.

Astrocyte induction studies

Monolayer culture of CD34+ stem cells was seeded at a density of 2 × 10 3 cells/cm 2 and induced with various supplements as mentioned in [Table 1]. The medium was standardized with 1 μM/mL RA in different combinations of 10 ng/mL fibroblast growth factor (FGF), 10 ng/mL epidermal growth factor, 20 ng/mL hydrocortisone, and 10 μg/mL insulin [Table 1] and cells were incubated at 37°C, with 95% humidity and 5% CO 2 atmosphere. The cells were observed and results were recorded every hour using a microscope image processing system (Magnus Analytics, New Delhi).{Table 1}

Astrocyte culture, maintenance and cryopreservation

The differentiated astrocytes in astrocyte defined medium (ADM) were purified, through the limiting dilution method (1 cell/100 μL) and sub-cultured with the same initiation medium and until the formation of pure astrocyte culture. The pure culture was cryopreserved in 10% dimethyl sulfoxide, 0.1% taurine, 0.1% trehalose and 0.1% catalase (Himedia). The cells were kept at −20°C for 1 h and followed by −86°C. The cryopreserved cells were checked from time to time by Leishman's stain. [1]

Kinetic characterization of GLUL and serine/threonine protein kinase (STPK) from differentiated astrocytes

Cell lysates of differentiated astrocytes were prepared using Lysis buffer containing 10 mM Tris pH 7.5, 200 mM NaCl, 0.2% triton X-100, 20 mM ethylenediaminetetra acetic by incubating for ½ h at 37°C and centrifuge at 13,000 rpm for 30 min at 4°C. Thus, obtained cytosolic fraction was used as an enzyme source for GLUL and STPK assay.

GLUL assay

GLUL activity was measured by estimating the inorganic phosphorous released in the reaction. [16] The reaction mixture contained the following components: 100 mM Tris HCl pH 7.5, 2 mM-14 mM glutamate, 10 mM Adenosine triphosphate (ATP), 50 mM MgCl 2 , 50 mM NH 4 Cl and cytosolic fraction as an enzyme source and incubated at 37°C for 10 min. The reactions were also carried out with varying ATP concentration (2 mM-16 mM), and were stopped by the addition of 0.5 ml of ferric chloride reagent, then 1 mL of acidified molybdate color reagent was added and measure reduced phospho-molybdenum complex at 820 nm in Cyber lab spectrophotometer, USA. The kinetic parameters VMax , KM, and Kcat were calculated using Hanes-Woolf plot ([S] vs. [S]/V).

STPK assay

The kinetics of serine/threonine kinase was determined [13] by using ATP 2 mM-14 mM and 250 μg/mL lysozyme, 0.1 M Tris HCl pH 7.5 and cytosolic fraction as an enzyme source and incubated at 37°C for 10 min. Then, the reaction was stopped by the addition of 0.5 mL of ferric chloride reagent; further 1 mL of acidified molybdate color reagent was added and reduced phospho-molybdenum complex was measured at 820 nm in cyber lab spectrophotometer, USA. Hanes-Woolf plot ([S] vs. [S]/V) was used to calculate the kinetic parameters like VMax , KM and Kcat .

Calibration curve of inorganic phosphorous

Standard graph was prepared by taking 20 μM- 140 μM concentrations of inorganic phosphate standard (KH 2 PO 4 ) and total volume made up to 2 mL with 0.1 M Tris HCl pH 7.5. After that, 1 mL of acidified molybdate color reagent was added and absorbance was measured at 820 nm against the blank. A standard linear curve was plotted by taking the absorbance on Y-axis and different concentrations of KH 2 PO 4 on X-axis.

Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of GFAP and GLUL genes

Isolation of total ribonucleic acid (RNA) and messenger ribonucleic acid (mRNA)

The total RNA was isolated from differentiated astrocyte culture and cultured CD34+ stem cells which served as control. Thus, isolated total RNA was analyzed by running 1.3% formaldehyde gel electrophoresis. From the total RNA, mRNA was extracted by using Oligo (dT) column chromatography and the eluted mRNA was precipitated using ice-cold isopropanol and the pellet was washed with 70% ethanol and air dried. The air dried pellet was suspended in 15 μL of nuclease free DEPC treated water and RT-PCR was performed. [1]

RT-PCR of GFAP and GLUL genes

One μg of total isolated mRNA was taken from both astrocytes and CD34+ human stem cells; the first strand complementary deoxyribonucleic acid synthesis was initiated at 42°C using one unit of avian myeloblastosis virus-RT for 1 h following manufacturer's protocol (Fermentas, USA). The following primers 5' GCAGTGCCCTGAAGATTAGCAG 3' for GFAP and 5' GCTCTGTCCGGATAGCTACG 3' for GLUL were taken in the reaction. Three fourths of the above reaction mixture was used as template in RT-PCR using the primers and conditions mentioned in [Table 2]. The PCR was carried out for 40 cycles and the obtained PCR products were analyzed by running 1.3% agarose gel electrophoresis along with standard molecular size markers (100 bp and Super mix ladder obtained from Bangalore Genei. Pvt. Ltd.). The results were recorded in Vilber Lourmat gel documentation system, France.{Table 2}

 Results



CD34+ cells were quantified and sorted by flow cytometry (8.5 × 10 4 cells/mL). Sorted CD34+ cells were first identified morphologically by Leishman's stain and further confirmed by immuno cytochemistry using anti-human CD34+ monoclonal antibodies (QBEND 10 clone) [Figure 1], [Figure 2]a and b. In all, 98% of the cells showed positive reactions to CD34+ which is the acceptable criteria for the further differentiation studies. Thus, obtained pure CD34+ cells were further cultured in DMEM for adherent monolayer cells (2 × 10 3 cells/cm 2 ). These cultured cells were used in the astrocyte induction studies with ADM and incubated at 37°C with 5% CO 2 and 95% humidity. The formation of astrocytes was carried out by varying the composition of ADM every time as mentioned in [Table 1]. At 1 μM RA and 10 ng/mL FGF of ADM showed CD34+ cells differentiated into cells with stellate morphology in the 11 h culture [Figure 3]. Thus, obtained astrocytes were further isolated using the limiting dilution method and were allowed to grow until pure astrocyte culture was obtained. In this culture GLUL, STPK activities and the expression of GLUL and GFAP were assessed.{Figure 1}{Figure 2}{Figure 3}

Total mRNA was isolated from both the cultured CD34+ cells and astrocytes were found to be 0.1% of the total RNA. This total mRNA was used as template in RT-PCR experiment and the amplicon sizes 2.9 kb and 1.5 kb corresponding to the conserved regions of GFAP and GLUL genes respectively obtained in the astrocyte culture and conspicuously were absent in CD34+ culture [Figure 4]. To ascertain these results further the kinetic description of the GLUL and STPK activities were determined in both astrocyte and CD34+ cultures. The GLUL and STPK kinetics are mentioned in [Table 3], [Table 4] and [Figure 5] and [Figure 6] respectively. From these results, it can be concluded that successful differentiation of human CD34+ stem cells into astrocytes.{Figure 4}{Figure 5}{Figure 6}{Table 3}{Table 4}

 Discussion



Astrogenesis is mediated through the complex formed between RAR-RXR which induces the transcription of glial specific genes. [8],[17],[18] In the present study, RA in the ADM successfully differentiated CD34 + stem cells into astrocytes, in which the expression of GFAP, GLUL and STPK were observed. The CD34 + cells obtained through apheresis technique were further purified by FACS and these pure cells were cultured in DMEM [1] thus, cultured CD34 + cells when induced with ADM got differentiated into cells showing stellate morphology which is the characteristic feature of astrocytes. The primers designed in the RT-PCR experiments for the expression of GFAP (2.9 kb, exons 1-9) and GLUL (1.5 kb, exons 2-8) were conserved in all isoforms of GFAP and GLUL confirming the formation of astrocytes in ADM. [19],[20] Further, the GLUL activity in growing astrocytes formed from CD34+ cells substantiates the RT-PCR results. [19]

It is very well-established that the phosphorylated form of GFAP provides high network with proper spatial orientation for intermediate filaments which supports the morphology of astrocytes. [21] We have also demonstrated the expression of STPK which phosphorylates specifically at 'Ser' and 'Thr' in protein and regulates their function. Presence of phosphorylation sites in GFAP (Thr-7, Ser-8, Ser-13, Ser-17 and Ser-34) and high activity of STPK in the differentiated astrocytes confirms the highly stabilized expression of GFAP in the differentiated astrocytes. These cells may be futuristic approach in the treatment of spinal cord injuries and some of the neurodegenerative diseases.

 Acknowledgment



We sincerely acknowledge Sri Venkateswara Institute of Medical Sciences (SVIMS University) for providing facilities to carry out the work. This paper forms a part of Ph.D. thesis work going to be submitted to SVIMS University, Tirupati, Andhra Pradesh, and India and G7 Synergon Private Limited for helping in the FACS analysis.

References

1Sarma PV, Subramanyam G. In vitro cardiogenesis can be initiated in human CD34+ cells. Indian Heart J 2008;60:95-100.
2Elabd C, Chiellini C, Massoudi A, Cochet O, Zaragosi LE, Trojani C, et al. Human adipose tissue-derived multipotent stem cells differentiate in vitro and in vivo into osteocyte-like cells. Biochem Biophys Res Commun 2007;361:342-8.
3Elabd C, Chiellini C, Carmona M, Galitzky J, Cochet O, Petersen R, et al. Human multipotent adipose-derived stem cells differentiate into functional brown adipocytes. Stem Cells 2009;27:2753-60.
4Taupin P. Neurogenic drugs and compounds. Recent Pat CNS Drug Discov 2010;5:253-7.
5Maden M. Retinoid signalling in the development of the central nervous system. Nat Rev Neurosci 2002;3:843-53.
6Blomhoff R, Blomhoff HK. Overview of retinoid metabolism and function. J Neurobiol 2006;66:606-30.
7Andrews PW. Retinoic acid induces neuronal differentiation of a cloned human embryonal carcinoma cell line in vitro. Dev Biol 1984;103:285-93.
8Asano H, Aonuma M, Sanosaka T, Kohyama J, Namihira M, Nakashima K. Astrocyte differentiation of neural precursor cells is enhanced by retinoic acid through a change in epigenetic modification. Stem Cells 2009;27:2744-52.
9Abbott NJ, Rönnbäck L, Hansson E. Astrocyte-endothelial interactions at the blood-brain barrier. Nat Rev Neurosci 2006;7:41-53.
10Castonguay A, Lévesque S, Robitaille R. Glial cells as active partners in synaptic functions. Prog Brain Res 2001;132:227-40.
11Verkhratsky A, Orkand RK, Kettenmann H. Glial calcium: Homeostasis and signaling function. Physiol Rev 1998;78:99-141.
12Eng LF, Ghirnikar RS, Lee YL. Glial fibrillary acidic protein: GFAP-thirty-one years (1969-2000). Neurochem Res 2000;25:1439-51.
13Harrison BC, Mobley PL. Phosphorylation of glial fibrillary acidic protein and vimentin by cytoskeletal-associated intermediate filament protein kinase activity in astrocytes. J Neurochem 1992;58:320-7.
14Eng LF, Ghirnikar RS. GFAP and astrogliosis. Brain Pathol 1994;4:229-37.
15Brenner M, Johnson AB, Boespflug-Tanguy O, Rodriguez D, Goldman JE, Messing A. Mutations in GFAP, encoding glial fibrillary acidic protein, are associated with Alexander disease. Nat Genet 2001;27:117-20.
16Gawronski JD, Benson DR. Microtiter assay for glutamine synthetase biosynthetic activity using inorganic phosphate detection. Anal Biochem 2004;327:114-8.
17Maden M. Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat Rev Neurosci 2007;8:755-65.
18Rivera FJ, Couillard-Despres S, Pedre X, Ploetz S, Caioni M, Lois C, et al. Mesenchymal stem cells instruct oligodendrogenic fate decision on adult neural stem cells. Stem Cells 2006;24:2209-19.
19Schmidt A, Braeuning A, Ruck P, Seitz G, Armeanu-Ebinger S, Fuchs J, et al. Differential expression of glutamine synthetase and cytochrome P450 isoforms in human hepatoblastoma. Toxicology 2011;281:7-14.
20Middeldorp J, Hol EM. GFAP in health and disease. Prog Neurobiol 2011;93:421-43.
21Bargagna-Mohan P, Paranthan RR, Hamza A, Dimova N, Trucchi B, Srinivasan C, et al. Withaferin A targets intermediate filaments glial fibrillary acidic protein and vimentin in a model of retinal gliosis. J Biol Chem 2010;285:7657-69.